Month: August 2019
Sleep Deprivation and Behavioral Issues in Children
Dr. Somnus, of Somnus Pediatrics, encounters numerous children in his practice who are affected by poor sleep habits. He suspects that there is a strong connection between disturbed sleep and behavioral problems in the children he sees. He is exploring what research suggests about the link between poor sleep and poor behavior as well as recommendations of possible intervention techniques that could improve sleep habits and behaviors among his patients. Backed up by research collected as a group, the team can conclude that poor sleep is severely detrimental to the neurobehavioral, as well as cognitive, development of children. However, the research also shows numerous intervention methods that both parents and Dr. Somnus can implement to achieve better outcomes for those children affected by inadequate sleep.
Research conducted by Sadeh, Gruber, and Raviv highlights a clear link between sleep quality and behavioral functioning and development in school-aged children. Within this study, a total of one hundred and thirty five (69 boys and 66 girls) healthy school-aged children from three distinct class groups (2nd, 4th, and 6th grades) were assessed objectively, using actigraphy and neurobehavioral functioning evaluations, in their homes for five consecutive nights. (Sadeh, Gruber & Raviv, 2002). The use of three distinct class groups in this study emphasizes a developmental perspective on this issue. More specifically, the researchers of this study were interested in comparing the effects of reduced sleep on behavioral functioning between younger and older children. In addition to this, the team of researchers also tested the neurobehavioral functioning of participants at two separate times during the day to consider when sleep quality more affected their performance; either earlier in the day, or later in the day. (Sadeh et al., 2002). The actigraph measures used in this study included: sleep onset time, morning awakening time, total sleep time, true sleep time (excluding periods of wakefulness), sleep percent, number of night wakings, longest sleep durations, and periods of quiet sleep with no movement. (Sadeh et al., 2002). Neurobehavioral functioning evalutations included tests such as: finger tapping, reaction time, continuous performance (CPT), symbol-digit substitution (SBS), visual digit span, and serial digit learning. (Sadeh et al., 2002). The CBCL was used to assess behavioral issues in the perspective of parents. (Sadeh et al., 2002).
Overall, the results show that sleep fragmentation can indeed negatively affect neurobehavioral functioning in almost all aspects of performance. Interestingly, the CPT results indicate that fragmented sleep increases impulsivity and behavioral inhibitionempirically linked to psychopathology in children, especially so in the younger ones compared to the older ones. (Sadeh et al., 2002). In terms of the time of day, poor sleepers tend to be largely affected during the early morning hours due to high levels of sleepiness or sleep inertia, and later in the day, some of these group differences disappeared. This suggests that both quantity and quality of sleep play a crucial role in alertness and performance among school-aged children. (Sadeh et al., 2002). Reports by parents on the CBCL indicated that, in general, good sleepers behaved better and regulated emotions better than poor sleepers. (Sadeh et al., 2002). There is a solid theoretical and empirical background that may lead to the interpretation that the compromised neurobehavioral functioning is a result of reduced alertness, or increased sleepiness associated with sleep fragmentation. (Sadeh et al., 2002, p.412).
Another source, research by Vriend, Davidson, Corkum, Rusak, Chambers, and McLaughlin, revealed that even slight but, cumulative differences in sleep duration over the course of a few nights, can present dire consequences in the daytime functioning of children. In this study thirty-two children between the ages of 8-10years were tested for three weeks using actigraphs; these children were randomly assigned to either go to bed one hour earlier or later for 4 nights, and then switched and completed the opposite conditions as well. (Vriend et al., 2013). After each week, both subjective and objective measurements where used to consider each child's emotional and cognitive functioning. (Vriend et al., 2013). Evidence showed that the children given the shorter duration of sleep versus the longer sleeper time, showed significant impairment in areas including: positive affective response, emotional regulation, short-term and working memories, and attention span. (Vriend et al., 2013).
Altogether, this study achieved a sleep difference of merely one hour or so in participants. Even this modest amount of sleep manipulation over the course of two weeks turned out to display a distinct difference between those that went from short-long and those that went from long-short in their sleep cyles. Many deteriorating effects in aspects of memory, attention and response were observed among parents of children during their short sleep duration week; however, not so in every aspect. In general however, shorter sleep durations clearly impaired critical areas of neurobehavioral functioning in children studied in this study. (Vriend et al., 2013). Although poor sleep cannot be considered the sole cause of behavioral issues, it is important to note that the potential for behavioral issues and diminished functioning increases tremendously with inadequate sleep in children.
Due to the copious amounts of evidence pertaining to the disastrous effects of improper sleep in young children, it is highly recommended that Dr. Somnus intervenes as soon as possible to rectify poor sleep habits in his patients. Intervention should be inclusive of parents as well, as they play a key role in the management and modeling of healthy behaviors in younger children. First and foremost, it is recommended that Somnus Pediatrics publically promotes sleep as a health-related behavior and stresses the importance of both quality and quantity of sleep among children. Tackling these poor sleep patterns and encouraging healthy sleep hygiene at an earlier age can create the foundation for children to better manage their sleep as they develop.
According to a study conducted by Bonuck, Blank, True-Felt, and Chervin, The most modifiable, prevalent, and consequential sleep problems in early childhood are insufficient sleep, behavioral sleep problems, and sleep-disordered breathing. Therefore, Dr. Somnus is recommended to focus his intervention on these specific categories. He should collaborate with parents to consider ways in encouraging children to sleep earlier, and maintain a regular bedtime schedule. In addition, he should rule out possible sleep and behavioral disorders among his patients so that he can alter and personalize his intervention techniques as needed.
Sleep problems can be prevented through implementation of proper sleep hygiene to regulate the internal circadian rhythm of developing children. This in turn conditions behavioral expression and regulation, as well as reduces excessive stimulation. (Bonuck et al., 2016). For younger children in particular, this includes interventions such as: instigating a regular bedtime routine, sleeping without the presence of parents in the room, and eliminating access to electronics and screen time fifteen to thirty minutes prior to settling down for the night. (Bonuck et al., 2016). Overall, anything that helps parents regulate the quantity and quality of sleep that their children receive is a good start to improving the development of neurobehavioral functioning and emotional regulation in children of all ages, but particularly younger ones.
Cite this page
Sleep Deprivation and Behavioral Issues in Children. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
How Sleep Deprivation Affects Cognitive Functions
Simply put, sleep deprivation occurs when an individual fails to get an appropriate amount of sleep according to their biological need. The amount of sleep required varies by person, but in general, adults need seven to eight hours and teenagers need about nine hours per night. In our busy world, many people fail to get enough sleep and suffer the consequences. According to the American Academy of Sleep Medicine, sleep deprivation has many negative consequences both physiologically and psychologically including the increased risk of serious medical conditions; lack of motivation, attention, and competency; and poor performance (2008). In this paper, I will explore the effects of sleep deprivation on cognitive functions, specifically from the cognitive and biological psychological perspectives.
Cognitive Perspective
In their article, Effects of Sleep Deprivation on Procedural Errors, Michelle Stepan, Kimberly Fenn, and Erik Altmann (2018) explore the cognitive effects that sleep deprivation has on procedural tasks that require memory. Stepan et al. note the proven effects that lack of sleep has on attention and vigilance but stress the need for more research on how sleep deprivation affects higher-order cognitive processes. The authors explain how their research is the largest known study on the impact of sleep deprivation on higher-order cognition. This study mainly focuses on how sleep deprivation affects memory and whether the effects are localized to cognitive deficits as a whole or solely memory processes. Acknowledging that sleep deprivation impacts ability and willingness, Stepan et al. hypothesize that deprivation most significantly affects memory maintenance above other cognitive processes.
In order to test this hypothesis, Stepan et al. selected 234 men and women Michigan State University undergraduates. The participants had no sleep or memory disorders, no morning or evening preference, and no major sleep disturbances. First, subjects completed a procedural task that consisted of a series of seven steps where subjects identified a different two-alternative forced-choice decision rule to apply to a randomly generated stimulus. The test provided no details about which step to do next, making the participants recall where they were in the sequence. While taking the test, the participant is interrupted every few trials for about 20 seconds. The participant then must continue the sequence with the right step and answer. In order to answer the question correctly, the participant must remember the last step completed before the interference. All participants completed the first part of the experiment together where they all took this same test one time. Then, they were randomly assigned to the control group who received a normal night of sleep and the experimental group who faced 24 hours of sleep deprivation before the second test. The participants took the same test again in the morning, and that was the conclusion of the experiment.
Results showed that sleep deprivation participants failed the second test at a higher rate than the participants who received sleep. The experiment group had a 15% fail rate, while the control group had a 1% fail rate. This shows that sleep deprivation caused 15% of participants to lose the ability or willingness to complete the same task they had successfully performed the day before. However, the researchers already concluded at the beginning of the study that sleep deprivation affects attention and ability as a whole. The researchers further analyzed the results to determine the effects on memory. The experiment had isolated the effects on memory by having two different trial type errors: one being after a regular step in the sequence and the other being after an interruption. Committing an error after an interruption indicated that the error was made because of a memory deficit, not from a general cognitive mistake. The data shows that sleep deprived participants made significantly more post interruption errors than the control group and made more post interruption errors as the second test progressed. The baseline sequence errors showed little deviation across both groups and progression throughout the test. This led the researchers to deduce that baseline sequence errors were not related to sleep deprivation and that sleep deprivation contributed mostly to post interruption errors. They concluded that the underlying factor is memory maintenance and that sleep deprivation impairs the mechanisms that manage the buildup of proactive interference (Stepan et al., 2018).
Biological Perspective
Also exploring the effects of sleep deprivation, Christopher Asplund and Michael Chee examined the biological aspect of the brain in their article, Time-on-task and sleep deprivation effects are evidenced in overlapping brain areas (2013). As in the cognitive perspective, the authors of this article also recognize that sleep deprivation is proven to degrade performance in tasks that require attention. The central focus of this research was to examine the effects of sleep deprivation on extended task engagement (time-on-task) and to determine if they overlap in areas of the brain. Time-on-task refers to the amount of time spent involved in a certain task. The researchers hypothesized that sleep deprivation worsens time-on-task because the two correlate and share overlapping areas in the brain.
To test this hypothesis, Asplund et al. selected 20 male and female participants from the National University of Singapore. All of the participants had regular sleeping habits, had no morning or evening preference, and had no psychiatric or sleep disorders. The experiment consisted of two parts: in the first, subjects had normal sleep and in the second, they were sleep deprived (meaning they stayed awake for 24 hours straight). First, the subjects completed an attention-demanding test after a normal night of sleep. The test required the participants to search for the letters J or K among a rapid stream of letters as fast as possible. Their brains were scanned throughout the test to measure cerebral blood flow. Secondly, the subjects had their brains scanned as they completed the same test again, only this time they were sleep deprived.
The results showed that cerebral blood flow changes in task-related neural activation in those sleep deprived versus those not sleep deprived. Consistent with the hypothesis, both sleep deprivation and time-on-task overlapped in a decrease of blood flow to the frontal and parietal cortices (specifically the attention regions) and the ventral visual cortex, which processes visual information. Because the two overlap in the brain, cerebral blood flow is drastically decreased when sleep deprivation is paired with time dependent situations. A decrease in blood flow to a certain area of the brain means decreased activation in that area. This causes a worsened time-on-task performance. Therefore, sleep deprivation worsens the performance of time-dependent evaluations from a biological perspective because the two are proven to overlap in the brain (Asplund et al., 2013).
Sleep deprivation is a serious, underlying issue that affects many individuals and societies today. In our world, busyness and being active have taken priority over sleep and rest, creating a nationwide sleep deprivation epidemic. This has negative impacts on productivity in the workplace and in the classroom. Although this problem is so prevalent, there is only one real solution for it: sleep. According to the American Academy of Sleep Medicine, The only sure way for an individual to overcome sleep deprivation is to increase nightly sleep time to satisfy his or her biological sleep need; there is no substitute for sufficient sleep (2008). Sleep cannot be replaced by caffeine or other stimulants or even naps. Only a good night of sleep will provide the best results.
Although making time to get more sleep can be very difficult, it is very important in order to improve learning. Research shows that sleep enhances memory of what was learned during the day, promotes creativity related to previous learning, and, overall, improves cognitive functions. One study found in Weiten's Psychology: Themes and variations supports these claims of how sleep improves learning. In the study, participants were first shown how to accomplish a perceptual-motor task and then retested 12 hours later. Those who slept during the 12-hour break proved to have significant improvement in performance compared to those who did not sleep (Weiten, 2017). These benefits of sleep have important implications for those wanting to maximize their productivity and overall success in the workplace or the classroom.
Conclusively, sleep deprivation is a serious issue affecting our society today. It has become a nationwide epidemic with detrimental side effects.
Cite this page
How Sleep Deprivation Affects Cognitive Functions. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
The Effects of Sleep Deprivation on Academic Performance
Sleep is an important biological necessity that all people need to maintain a healthy lifestyle. It helps people work at an optimum level and is critical for brain functioning, helping with all the cognitive functions such as memory, learning, decision making, and critical thinking. This makes sleep extremely important for academic performance. However, research shows that not everyone is getting enough sleep to function properly, especially college students. Researchers state that sleep deprivation is one of the main reasons college students receive low academic scores aside from stress which contributes to sleep deprivation. The purpose of this research proposal is to examine what contributes to sleep deprivation and see how it then affects academic performance.
The Effects of Sleep Deprivation on Academic Performance
Sleep is a vital necessity for people to live a healthy lifestyle in which they can function well and think properly. It helps with memory consolidation, learning, decision-making, and critical thinking (Gilbert & Weaver, 2010). Therefore, sleep deprivation is necessary for keeping these cognitive functions at an optimal level for performance wherever the person may be, whether it be at work, home, or even school. Unfortunately, not everyone receives adequate amounts of sleep in order to function properly throughout the day. These poor performances as a result of poor sleep quality and sleep deprivation is especially evident among college students. Since college students have such busy work, school, and social schedules to keep up with, their sleep cycles become negatively affected by it. They tend to have irregular sleep-cycles depending on the day of the week and report dissatisfaction with sleep as a result of poor sleep quality (Gilbert & Weaver, 2010).
Causes of Sleep Deprivation
There are many causes as to why sleep deprivation occurs in college students. In a study done by Ahrberg and his colleagues (2012), they found that different modes of stress affect the circadian sleep rhythms of the students. OF these modes of stress, stress from work and school are the most prevalent. A working student can feel stress from going to school, then working to hard at their job, and then having to come home to do more schoolwork until the early hours of the day. Students who do not have a job may also feel the same stresses as working students if they spend too much time procrastinating and have to spend time working on schoolwork until the early morning as well. Ahrberg and his colleagues (2012) also state that as a result of sleeping this late, sleep deprivation acts as another stressor on the student.
More causes of sleep deprivation as stated by Tsai and Li (2004), are gender and grade differences. In Tsai and Li's study, they found that female students tend to receive lesser sleep with poorer sleep quality and more awakenings in the middle of the night compared to male students. The male students would receive more sleep with better quality. This is because women went to bed later but rose earlier. According to Tsai and Li (2004), younger students such as college freshmen also tended to sleep less than college seniors no matter what their gender. This may be because of fewer workloads and the more relaxed attitude of college seniors since they have their life more balanced out as opposed to the incoming freshmen that are just trying to figure things out. The college freshmen may feel more stress as they try to balance having a social life and keeping up with their academics at the same time. As a result, sleep deprivation can be caused by both gender differences and grade differences.
Sleep Deprivation and Academic Performance
Many studies in the past have shown that sleep deprivation does correlate with poor academic performance because of lower abilities in cognition as a result of poor sleep quality. In the study done by Gilbert and Weaver (2010), the two researchers found that sleep loss interferes with a student's academic, extracurricular and vocational choices. They also found that the amount of hours students sleep in a 24-hour period has greatly decreased over the years while sleep dissatisfaction has increased. Another study done by Medeiros and three other colleagues (2001), found a correlation between poor academic performances and sleep deprivation but in this study, they analyzed how irregular sleep cycles can be the result of different days of the week. For example, their participants tended to have prolonged sleep during the weekends because of their loss of sleep during the weekdays because of school (Medeiros et al., 2001). Since humans have the tendency to continue sleeping late as the result of their human circadian rhythm, sleep deprivation is further worsened (Medeiros et al., 2001). As stated before by Ahrberg and his colleagues (2012), stress can also worsen the desynchronization of circadian rhythms and make people moody and cause them to not be as alert as they should be. In a similar study done by Kelly, W. and two other colleagues (2001), they also found that sleep deprivation greatly affects a student's ability to perform well in their classes. This is evident through the students' GPA's. Kelly and colleagues reported that people who slept 9 hours or more in a 24-hour period had significantly higher GPA's than short sleepers who sleep 6 hours or less in a 24-hour period. These short sleepers also tended to show signs of anxiousness, were less creative, more neurotic, and more prone to hallucinate as well (Kelly, Kelly, & Clanton, 2001).
Hypothesis/Rationale
The purpose of this research is to examine what contributes to sleep deprivation and see how it then affects academic performance. Past research has shown the effects of stress, gender, and grade differences on sleep deprivation. It would also be interesting to see if there are other factors that worsen sleep deprivation. Hypothesis: Participants who are female, have high amounts of stress, and are college freshmen are more likely to experience more sleep deprivation and as a result perform poorly academically.
Method
Participants
The data will be collected from undergraduate psychology students at the California State University of Long Beach. The expected students' ages would range between 18 and 23. Around 150 participants are expected to be selected through a cluster sampling procedure, where 75 participants would be males and 75 participants would be females. These students would be chosen in an introductory psychology class after taking a test. The participants would be asked to complete a survey regarding their sleep patterns, stress levels during the semester, pre-test, and post-test, and their academic performance such as GPA and how they perform in class.
Materials and Measures
Materials. Paper and pencils would be needed to distribute the surveys to the participants in the classroom. Measures. Demographics such as gender and grade level will be collected because past research has shown that females are more likely to become victims of poor sleep quality and sleep deprivation while it also depends on their grade level differences (Tsai & Li, 2004). It would also be interesting to see whether or not ethnicity correlates with sleep deprivation in any way and how it affects their academic performance. For this experiment, the Pittsburgh Sleep Quality Index (PSQI) will be used to measure the subjective sleep quality in participants (Ahrberg, Dresler, Niedermaier, Steiger, & Genzel, 2012). The 6-point Kunin's faces scale will also be used to measure stress in the participants, along with a survey of five questions regarding their thoughts on their academic performance in the class.
Procedure
Before the day the survey will be taking place, the professor of the introduction to psychology class will be asked for permission to have the survey take place in their classroom after the students have completed one of the midterm exams for the class. After getting the professor's consent to work in his classroom, a schedule would be set for the day the survey will take place. On the day of the survey, one of the researchers for this study will enter the classroom to greet the students before their midterm exam and to inform them of the survey that will be taking place after the exam if the students choose to participate. The participants would be informed by the researcher that the results would be confidential and anonymous, and if he or she feels the need to leave at any time during the survey they may do so without feeling uncomfortable in any way and without receiving any penalties. The students would be asked to stay behind after they have completed their exams to complete the survey. Once a student has completed his or her midterm exam, they student would bring up their exam to the front of the classroom to hand their exam in. Then the researcher supervising that classroom would hand the student a survey for them to complete if they choose to. On the first page of the survey, the participant would be given a consent form to read and sign regarding the experiment. After reading and signing the consent forms, he or she would understand that the experiment is investigating what causes sleep deprivation and how sleep deprivation affects academic performance. In the survey the participant would be asked a total of 18 questions regarding their sleep patterns, stress levels during the semester, pre-test, and post-test, and their academic performance. The first section of the survey, which would be a PSQI, would be made up of 10 questions related to sleep habits over a one-month period and includes subscales assessing sleep latency, sleep duration, sleep disturbances, and daytime-dysfunction (Ahrberg, Dresler, Niedermaier, Steiger, & Genzel, 2012). This section should take about 5 minutes. The second section of the survey would consist of three of Kunin's faces scale to measure stress levels during the semester, pre-test, and post-test. This section should take about 1 minute. The final section of the survey would consist of five questions asking about the participant's academic performance. These questions would pertain to the participant's GPA, their ability to focus in class, how they work with other students in the class, their ability to stay awake in class, and their overall mood during class. After completing the survey, the participant will be thanked for participating in the study and will be given a cup of coffee or hot chocolate as a reward and to keep them awake in the rest of their classes, and they will finally be dismissed.
References
Ahrberg, K., Dresler, M., Niedermaier, S., Steiger, A., & Genzel, L. (2012). The interaction between sleep quality and academic performance. Journal of Psychiatric Research. Advance online publication.
https://dx.doi.org.mcc1.ilbrary.csulb.edu/10.1016/j.jpsychires
Cite this page
The Effects of Sleep Deprivation on Academic Performance. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Debate in Hip Hop Culture
When we look at the lyrics of Hip-Hop songs, we mostly can see that rappers were telling stories that they were faced with such as street crime, alienation, rage, drug trade, prison life or violence which was a way of complaint about their lifestyle or how they were threatened as well. We have to accept that rap artists were influenced, and they were the products of the life that they grew up in. However, it was a huge problem for new generation because the violence that was told in lyrics by rappers were ridiculed and seen as bad impact on teen listeners. Seeing rap artists as role models caused an imitation life styles and similar characteristics on teens as well. Hunt who did the documentary had a trip to Spring Bling which is a rap festival in Florida. (Hunt)His point was to analyze teen rappers and listeners and, see young men and women to talk about how manhood is displayed in hip-hop culture. After he let some young rappers to sing, he realized that their lyrics were consist of gunplay, killing other man, being tough and invulnerable, feminizing other men, and putting fear into another man's heart. Those violent-portraying lyrics and horrible real-life examples that were reflected in songs at the beginning of Hip-hop culture caused young African-American community negatively.
Hip-hop was created in the ghettos who are poor African Americans, Jamaicans and West Indians. Instead of breaking stereotypes by the time, new generations adopted the hip-hop culture that they saw from older generations. The gun became the outlet for the aggression and the rage that young black and brown men feel. Masculinity was an issue for them because there was a whole lineage of black men wanting to deny their own frailty which forced them to be violent, misogynist, and a different person. In an interview with Fat Joe who was the rapper in Bronx, Hunk asked 'why is it so important to be hard in hip-hop? And he complained that everybody transformed to different person when they get the microphone in night clubs (Hunt). Also, he added that people hate each other instead of dancing and smiling each other when they were influenced by being hard all the time. In another interview with Mos Def and Talib Kweli, he was willing to learn why rappers projected an image of toughness and invulnerability in hip-hop. Def pointed out that every male want respect and he claimed toughness and invulnerability as a part of man's life. Kweli added that hip-hop was a very ego-driven thing and it encouraged people to assert themselves (Hunt). These arguments show that hip-hop culture created a forced environment which occurred masculinity, violence, misogynistic, and hatred among people.
People are undoubtedly influenced by rappers. Teaching young people that real man is tough, violent, control women, cannot show weaknesses under any circumstances hurts teens' personality traits and their potential as well. Rose touches upon the rehabilitation and community projects to fight against violence for a positive resolution. By, she argued that following policies in rehabilitation and community projects must be a solution to stop violence in these neighborhoods. (Rose pg 59-60)
The hip-hop depicts African-Americans as poor, violent, drug dealer, and thugs which demonstrates the hip-hop music as a cultural violence and create a negative stereotype of African American community because hip-hop music contained all negative forms that influence young generation badly. However, to understand the hip-hop culture , it is necessary to analyze the systematic political and economic oppression that they were faced with which was accepted as a main problem of violence in hip-hop because it is a resistance to the system of subjugation.
Cite this page
Debate in Hip hop culture. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
The Effect of Sleep Deprivation on Adolescents
Does the amount of sleep adolescents get cause or contribute depression and/or anxiety? I became interested in the topic of sleep because I have not been getting enough of it myself and I wanted to know if it was affecting the way I think. I feel that knowing the contribution that sleep has on the brain development of adolescents would help me understand if my lack of sleep is contributing to my anxiety. In addition to that, studying sleep's effect on brain development might help the education system improve the way they teach children with the work they give them to do outside of class.
Natural Sciences
Allen, Nicholas B, et al. Systematic Review and Meta-analysis of Adolescent Cognitive-Behavioral Sleep Interventions. Clinical Child & Family Psychology Review, Vol. 20 Issue 3, September 2017, p227-249. 23p. Academic Search Complete, doi: 10.1007/s10567-017-0234-5
The article states that most youths get around 9 hours of sleep when unrestricted and less than 8 hours of sleep when restricted, typically on school nights. Adolescents are recommended to get 8 to 10 hours of sleep a night and the article proclaimed that approximately 30% of adolescents suffer from a sleep disorder being either insomnia or delayed sleep phase disorder (DSPS). The article also states that adolescents are susceptible to the same physiological, psychological, and environmental vulnerabilities that cause these disorders as adults as well as still developing responsibilities and social interests, still developing as human beings, and the amount of hormonal changes leading to a perfect storm of sleep imbalance.
The article was last updated in September of 2017 and has not been revised. The article focuses on the effects of sleep on mental illnesses. The source used many statistics that younger students would not understand so the intended audience might be high school or college students. The authors of this article were researchers associated with the Melbourne School of Psychological Sciences a part of the University of Melbourne and Oregon Research Institute, several of which have written other credible articles. Since the article focused mostly on the results of their meta-analysis the results may vary from others who recreate it but not by enough to discredit this source and was peer reviewed to add credibility. This article exists to inform of the connection between sleep and some mental disorders.
Boynton, Marcella H., Leslie A. Lytle, and Deshira D. Wallace. Multilevel analysis exploring the links between stress, depression, and sleep problems among two-year college students. Journal of American College Health. Vol. 65 Issue 3, April 2017, p187-196. 10p. Academic Search Complete, doi: 10.1080/07448481.2016.1269111
This article covers the connections between depression and stress and sleep issues in college students. Through their study they deduced that in 2-4-year college students 30% of them reported being so depressed that it was difficult to function at some time in the past year (11). It also states that the causes for depression among young adults may be the result of poverty, stressful life events, maltreatment, and family dysfunction (187). With this information the researchers tested a group of 440 college students with 70% of the subjects reporting insufficient sleep. Through their study they found the depression does not affect the quantity of sleep, but it affected the quality.
The article was last updated in April of 2017 and has not been revised. The article focuses on the effects of depression on sleep. The source used many statistics that younger students would not understand so the intended audience might be high school or college students. The authors of this article were researchers associated with the UNC Gillings School of Global Public Health, several of which have written other credible articles. Since the article focused mostly on the results of their two year study the results may vary from others who recreate it but not by enough to discredit this source and was peer reviewed to add credibility. This article exists to inform of the connection between depression and sleep quality.
Carper, Matthew, Philip Kendall, and Jeremy Peterman. Anxiety Disorders and Comorbid Sleep Problems in School-Aged Youth: Review and Future Research Directions. Child Psychiatry & Human Development. Vol. 46 Issue 3, June 2015, p376-392. 17p. Academic Search Complete, doi: 10.1007/s10578-014-0478-y
The article begins by outlining general issues, such as sleep problems in youths without anxiety, sleep across a youth's development, sleep measurement, and negative functional outcome related to sleep disturbances. Questioning into these topics will provide context to understand the current state of the anxiety and sleep literature, including methodological shortcomings and areas that need further investigation. Second, the article explores associations between anxiety and sleep among youth with anxiety disorders, with an emphasis on studies' collective strengths and limitations.
The article was last updated in June of 2015 and has not been revised. The article focuses on the effects of sleep on an adolescent's development. The source used many statistics that younger students would not understand so the intended audience might be high school or college students. The authors of this article were researchers associated with Temple University's Child Psychiatry & Human Development research program, several of which have written other credible articles. The article used their own research and multiple other articles to confirm their findings along with being peer reviewed. This article exists to inform of the connection between sleep and anxious tendencies in adolescents.
Lehto, J. E., and L. Uusitalo?Malmivaara. Sleep-related factors: associations with poor attention and depressive symptoms. Child: Care, Health & Development. Vol. 40 Issue 3, May 2014, p419-425. 7p. Academic Search Complete, doi: 10.1111/cch.12063
This article aims to add to the missing area of research of children's sleep related problems and co-occurring emotional and behavioral disturbances. There is mounting evidence showing that children with ADHD (Attention Deficit Hyperactivity Disorder) have sleep problems. There is also evidence suggesting that the symptoms of ADHD are related to sleep factors in children with no diagnosis of true ADHD and this article intends to prove it.
The article was last updated in May of 2014 and has not been revised. The article focuses on the effects of depression on sleep. The source used many statistics that younger students would not understand so the intended audience might be high school or college students. The authors of this article were researchers associated with the Special Education Section of the University of Helsinki, both of which have written other credible articles. The article is based off previous articles relating to the subject along with their own research that has been peer reviewed. This article exists to inform of the connection between sleep quantity and behavioral disturbances.
Social Sciences
Gayathri, R., and Abigail Nirandhi Ranasinghe. Awareness of effects of sleep deprivation among college students. Drug Invention Today. Vol. 10 Issue 9, September 2018, p1806-1809. 4p. Academic Search Complete
This article explains the effects of sleep deprivation on college aged students. This article shows that sleep deprivation can be either chronic or acute which changes the effect it has. A chronic sleep-restricted state can cause fatigue, daytime sleepiness, clumsiness, and weight loss or weight gain. It adversely affects the brain and cognitive function. Sleep deprivation tends to cause slower brain waves in the frontal cortex, shortened attention span, higher anxiety, impaired memory, and a grouchy mood.
The article was last updated in September of 2018 and has not been revised. The article focuses on the effects of sleep deprivation on the lives of college students. The source used many statistics that younger students would not understand so the intended audience might be high school or college students. The authors of this article were researchers associated with the Saveetha Institute of Medical and Technical Science, both of which have written other credible articles. The article references other articles relating to the subject and has been peer reviewed. This article exists to inform of the connection between sleep deprivation and the mental state of college students.
Louca, Mia, and Michelle A. Short. Sleep deprivation leads to mood deficits in healthy adolescents. Sleep Medicine. Vol. 16 Issue 8, August 2015, p987-993. 7p. Academic Search Complete, doi: 10.1016/j.sleep.2015.03.007
The objectives of the study were to investigate the effects of thirty-six hours of sleep deprivation on the discrete mood states of anger, depression, anxiety, confusion, fatigue, and vigor in healthy adolescents. This study provides empirical support for the notion that sleep loss can causally affect mood states in healthy adolescents, with females having heightened vulnerability.
The article was last updated in August of 2015 and has not been revised. The article focuses on the effects of sleep on adolescent's moods. The source used many statistics that younger students would not understand so the intended audience might be high school or college students. The authors of this article were researchers associated with the Centre for Sleep Research at the University of South Australia, both of which have written other credible articles. The article was mostly their own lab work that was peer reviewed with the help of previous articles on similar subject matter. This article exists to inform of the connection between depression and sleep quality.
Cite this page
The Effect of Sleep Deprivation on Adolescents. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Utilitarianism or Deontology
Cite this page
Utilitarianism Or Deontology. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Comparison of Utilitarianism and Deontology
Utilitarianism vs Deontology
Utilitarianism is an ethical theory that the best action is the one that maximizes utility, (Wikipedia.com, Utilitarianism). This is stating that it is morally good to use human lives if there is a greater good is the result. An example of this would be getting an abortion. Utilitarianists believe that committing an abortion is morally okay as long as it leads to a good result for the majority, (iep.utm.edu, Act and Rule Utilitarianism). Also, utilitarianist reject moral codes or commands that are considered taboo that is based on customs, traditions, or orders given by leaders or supernatural beings, ( iep.utm.edu, Act and Rule Utilitarianism). Instead, they prefer a positive contribution to human beings.
Another example of utilitarianism is eliminating certain people and saving valuable resources for other people that will benefit from them. This is also known as rationing, and is stated as unavoidable because the needs for it are limitless, (ncbi.nlm.nih.gov, Ethics and rationality of Medicine). For instance, a person is considered brain dead and has little to no chance at recovering can provide about ten organs and at the same time is not using up valuable resources.
Recently in the news, there have been numerous reports from Iceland that doctors there have discovered a cure for Down Syndrome, (cbsnews.com, Down Syndrome Disappears). Upon closer examination, it has been discovered that doctors have not cured Down Syndrome, but they have killed all those unborn babies who they believe will be born with the disease. These doctors have been using prenatal testing to determine if the unborn baby will get this genetic disease or not. According to recent data studies, the United States has a sixty-seven percent termination rate, and Denmark is ninety-eight percent rate, (cbsnews.com, Down Syndrome Disappears). A utilitarianist would believe that aborting these unborn babies with defects is for the greater good. This is because utilitarianist believes those born with these genetic defects are draining valuable resources, and in certain situations, those resources would be limited and should not be wasted on defective people. So, the death of the unborn is being used to achieve the greater good. Another view of this the practice of genocide, deliberate killing of a large group of people, especially those apart of a particular ethnic group or nation, (Wikipedia.org, Genocide definitions). Not only is a certain group being targeted, but it's also a group that requires more protection for those with this disability.
The complete opposite of utilitarianism is Deontology. Deontology is The study of the nature of duty and obligation, (wikipedia.com, Deontological Ethics). Meaning it is never morally correct to use a human being only as a means to a further end. For instance, each and every human life, no matter the stage of development or condition the person is in, it is inherently valuable. As human beings, we are rational with a free choice who prefer to not be used as tools for someone else's purpose.
Kant's theory states Act in such a way that you treat humanity, whether in your own person or in the person of any other, never merely as a means, but always at the same time as an end, (link.springer.com, Abstract). Kant is simply suggesting that if his Principle of Humanities were followed, the world would be perfect.
Principle of Humanities is the study aspects of humanity and culture, (Humanities, en.wikipedia.org). This is stating that we can never use human beings as a means to an end. Meaning we as humans should never use one another as a tool. But, we can use people generally under certain circumstances. An example of this would be asking someone to borrow twenty dollars and giving them the exact reason why you would be borrowing. For instance, Asking a parent for twenty-dollars to put gas in your car is a great example to explain the Principle of Humanities.
If we apply deontology to the issue of killing unborn children that are prone to down syndrome, we see that neither side is morally permissible to treat one another as a means to an end. We humans should always recognize the person, born or unborn. The act of killing an innocent child because of what genetic disformity it will have is clearly treating oneself as a means to an end, as the woman carrying the unborn child as a means to end the baby's life to save herself from having to take care of it once it is born, or as a way to save money from having to pay to deal with this kind of special needs child. Then the mother's life becomes a means to an end and that is wrong. We as a society do not allow a woman to be this irresponsible to end a human life just because of the troubles it could cause them mentally and financially. Also, doctors should be involved in the decision making because an abortion can cause harm to a woman's health, ( https://www.bbc.co.uk,Safety of Women). Doctors use to take the Hippocratic oath, stating I will not give a woman an abortive remedy, (www.medicinenet.com, Classic Hippocratic Oath). Doctors are meant to cure and heal the sick, not to kill human beings.
For the issue of killing an innocent baby born with Down Syndrome, I argue that we should not kill the innocent baby to benefit someone else. First, I believe it is wrong to use a human being that has not even had a chance to live, for parts. Even if the person is not fully grown or harmed in any way. There is no price that compares to a humans life. Utilitarians do not view life this way, they see humans as a resource to get what they want. Those who need help the most should not be killed and used, they deserve to live and be protected. Second, a prenatal test does not guarantee that the child will have Down syndrome, it is just showing if the risk is high or low, (cbsnews.com, Down Syndrome Disappears). If the unborn child ends up not having Down Syndrome, then the abortion was performed for no reason. Lastly, a doctor cannot be one-hundred percent sure that the unborn baby has any kind of disease until it is born. Therefore, killing an innocent an possibly unharmed by genetics child is wrong.
When a woman is told her child could possibly be born with a genetic disorder, she should be fully informed on the causes that could happen to the baby and herself. Especially her health if the doctor is trying to convince to have an abortion. An abortion can have a psychological and emotional impact on a woman's body, (www.labroots.com, Affects the Woman). Therefore, Doctors have to give the woman consent. Meaning the woman has to be fully aware of what could happen to her body and the unborn child. Doctors are known for not telling all the side affects of procedures or medication when giving them to their patient. So, I will not allow myself to undergo an abortion just because my child would be born with a genetic disorder. This is because there is a chance of infertility, or perforate the lining of my uterus, and that can cause infection and even sepsis,(www.labroots.com, Affects the Woman).
There is such thing as an non-voluntary euthanasia, and this includes abortion, (https://www.life.org.nz, Abortion/Euthanasia). These two types of murder are morally wrong, and to this day are being debated as to what life is said to be. Euthanasia targets groups such as people that are sick, disabled, and old. In Iceland, unborn children are being killed for having a genetic disease called Down Syndrome, (cbsnews.com, Down Syndrome Disappears).
Citation Page
- Atwell, John E. The Principle of Humanity. SpringerLink, Springer, 1 Jan. 1986, link.springer.com/chapter/10.1007/978-94-009-4345-2_6.
- Deontological Ethics. Wikipedia, Wikimedia Foundation, 8 Nov. 2018, en.wikipedia.org/wiki/Deontological_ethics.
- Ethics - Abortion: Safety of Women. BBC, BBC, www.bbc.co.uk/ethics/abortion/mother/safety.shtml
- Genocide Definitions. Wikipedia, Wikimedia Foundation, 8 Apr. 2018, en.wikipedia.org/wiki/Genocide_definitions.
- How an Abortion Affects the Woman | Videos. LabRoots, LabRoots, Inc., www.labroots.com/trending/videos/9914/how-abortion-affects-woman-s-body.
- Humanities. Wikipedia, Wikimedia Foundation, 8 Nov. 2018, en.wikipedia.org/wiki/Humanities.
- Internet Encyclopedia of Philosophy, Internet Encyclopedia of Philosophy, www.iep.utm.edu/util-a-r/.
- Internet Encyclopedia of Philosophy, Internet Encyclopedia of Philosophy, www.iep.utm.edu/util-a-r/.
- Lajka, Julian Quinones Arijeta. ?What Kind of Society Do You Want to Live in?": Inside the Country Where Down Syndrome Is Disappearing. CBS News, CBS Interactive, 14 Aug. 2017, www.cbsnews.com/news/down-syndrome-iceland/.
- Medical Definition of Hippocratic Oath. MedicineNet, www.medicinenet.com/script/main/art.asp?articlekey=20909.
- The Abortion/Euthanasia Connection. Impact of Euthanasia on the Family | The Life Resources Charitable Trust, www.life.org.nz/abortion/abortionkeyissues/euthanasialink/.
- Utilitarianism. Wikipedia, Wikimedia Foundation, 4 Nov. 2018, en.wikipedia.org/wiki/Utilitarianism
Cite this page
Comparison Of Utilitarianism And Deontology. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
War on Drugs in Modern World
War on Drugs
The War on drugs is a war on people and a war on progress, said Michael K Williams in his CNN piece, The war on drugs is war on people. Drug wars destroyed family's lives, crowded our jails, prisons and robbed futures of black and brown communities”that's what drugs do, they destroy people. According to Williams, the war on drugs has not made America a safer place. The war on drugs has a way of demonizing and silencing black youth generations, for at least 45 years. Studies show that in 2014, an average of 2.2 million people were incarcerated”raising the percentage to 350% over 4 decades. As of today, 60% of people behind bars are black or Hispanic. Studies showed 1 out of 3 men who are locked up in prison are black or Hispanic. Reports indicated that white men are less likely to end up in jail than black men. Bruce Western reported that 41% of all black males who dropped out of high school before the age of 30 have a higher risk of getting arrested and locked up in jail. The Justice Department claimed 1 out of 8 black males are locked up before the age of 30.
Jeffery A. Miron, a professor of Economics at Boston University gives his history about the war on drugs. Miron explained how the United States put away 38,000 people behind bars for drug possession and drug offenses. Miron reported that 1.2 million out of 1.5 million people are locked up in jail or prison for drug possession offenses only. Many arrests for possession occur because the arrestee violated some other laws”prostitution, theft, speeding, loitering, disorderly conduct, and so on”and was found to possess drugs. Thrus, otherwise law-abiding citizens who wish to purchase and consume drugs face minimal risk of arrest or other situation, Says Miron. Michael K Williams, a Brooklyn actor, speaks out about his experience and struggle with substance abuse. Williams claimed he received treatment to help control his drug addiction. Later, William said he would rather experience being jailed for his past addiction issues. Williams revealed how he overcame his drug addiction but never got to experience any arrests.
President Barack Obama focused on more drug offenses than any other president in the United States. The Department of Justice delivered a message to end any usage of private prisons. The United States Senator considered reducing mandatory sentencing by giving judges the opportunity to hand down sentences to fit each crime. First lady Nancy Reagan wanted to change current laws that interfered during the crack epidemic in the 1980's. Reagan created a campaign called Just Say No to decrease demand. Although Reagan tried to send a message to the United Nations Audience on the 25th of Oct. 1988. Regan claimed to the United Nations Audience that the U.S had the highest ranking for drug abuse in the world. The war on Mexico continues with violent drug crimes and rival cartels. Anne Deslandes wrote an article on Guerro Mexico's failed attempts on drugs. Deslandes, mentions in her article that Guerro, Mexico lost 2,318 people from violent homicide attacks involved with drug trafficking.
Deslandes talks about the war against poppy farming and crack downs from the National Army in Mexico. Deslandes explains how Mexico should legalize poppy production to farmers in Mexico that allow the farmers to cultivate their products-- without being in danger from cartels and the Mexican government. A former president, Ernst Zedillo, encouraged law makers in Mexico, saying: Give the benefit of the doubt to those of us who have followed the wrong policy for many years. Later, Deslandes describes how lawmakers reached out to the national government hoping they would consider changing their policy to legalize growing the farmer's poppy plants allowing them to use the opium for medical use and pharmaceutical use only. Statistics mentioned in Deslandes article show how legalizing the farmers poppy plants would decrease violence with drug cartels and the government. Deslandes explained that former lawmakers agreed to consider legalizing farmers to grow poppy plants and use their opium for medical and pharmaceutical use. Deslandes points out that decriminalization would cut out drug traffickers and weaken them.
Also, Deslandes argues for the legalization of marijuana because it decreased drug cartel profits. Reproduction of poppy plants and opium would also decrease its values to cartels. Deslander claims the farmers in Geurra Mexico came to a disagreement with the legalization of poppy plants. The farmers feared if their poppy plants were legalized it would become a major problem. Deslandes reported that 50,000 people in Mexico who rely on the production of cultivating their poppy plants, and without poppy farming, people would be out of a job”no reliable income. Deslandes solution explains that legalizing the production of poppy plants can decrease government raids. The former president- elect was on board with this law being reviewed and said he would not rule out the bill. Unfortunately, this agreement did not yet pass Today, the Mexican government and drug cartels continue fighting for territory. Cartels continue spilling blood and ruining the lives of innocent people to get what they want. In 2015, the Congressional Research Service report showed an average of 80,000 people who were killed by drug cartels in Mexico.
Drug cartels in Mexico make around 19 billion to 29 billion dollars a year in drug trafficking. The Sinaloa cartel is the highest-ranking dominant drug trafficking cartel in Mexico According to reports from the Council of Economic Advisors, opioid usage increased their costs each year”roughly $500 billion in tax revenue in 2015. Eight billion dollars alone was used alone for the criminal justice enforcement. In 2014, President Enrique Pena Nitro celebrated victory for arresting a former drug lord named El Chapo”the most successful drug lord in history for the Sinaloa Cartel. Patrick Redden Keefe mentioned how the Sinaloa Cartel makes an estimate between $18 billion dollars to $39 billion dollars a year importing and exporting drugs across the border of Mexico. Keefe described the total amount in revenue that all cartels in Mexico derive from importing and exporting drugs across the U.S border, estimated a total amount of $6.6 billion annually each year. Keefe states that the Sinaloa Cartel achieved a market share minimum of 40% and 60% with a total of 3 billion dollars. Leader of the Sinaloa Cartel, Chapo Guzman, was known to be the most powerful and richest drug lord in Mexico of all time. Chapo Guzman's organization made two times the amount Pablo Escobar did.
Close studies showed the Sinaloa Cartel now controls more territory around the Mexican border than any other cartel in Mexico. Keffer also claimed the Sinaloa Cartel to be the most successful organization in history today. Teri Moore described the legalization of marijuana and how it can benefit and reduce percentages of current opioid users. Moore also states that marijuana has reduced the social harms relating to opioid use. The University of British Columbia reviewed patient surveys which showed 63% of patients switched from opioid prescriptions to medical marijuana. Studies also showed 30% of the patients stayed on their opioid prescriptions. As a result, Moore mentioned medical marijuana legalization decreased by 23% of all opioid hospitalization visits. Moore explained how users are most likely unaware of their dosage intake and buy opioids illegally from the black market. Moore also explained how marijuana can reduce problems if people substituted their medications. According to the National Cancer Institute, lethal overdoses from medical marijuana cannot occur because the dosage is unknown.
In 2017, a study from the American Journal of Public Health discovered opioid rates in Colorado decreased after marijuana became legalized for recreational use. Moore detailed on how the black markets pricing for marijuana was no longer known for having unbeatable prices because Colorado and Washington state decreased their market prices for marijuana to eliminate the black-market value for their products. Moore's pros for marijuana legalization would not only bring transparency to future business transactions but address how the war on drugs had failed. Moore claims the benefits of recreational/medical marijuana legalization can help users overcome dangerous addictions from opioids if they replace it with marijuana. In sum, legalizing drugs can help prevent crime from cartels and minimize violence. Doing so would reduce the number of people killed in drug trafficking-related incidents and help boost economies with legally medicinal and recreational use.
MLA Cited Sources:
- Keefe R, Patrick. Cocaine Incorporated. New York Times, Date: 15 Jun 2012. URL: https://www.nytimes.com/2012/06/17/magazine/how-a-mexican-drug-cartel-makes-its-billions.html. Accessed: 29 Nov 2018.
- Mexico's Drug War Fast Facts. CNN Wire, Date: 12 Jun 2018. www.link.galegroup.com/apps/doc/a54234633/ovic?=sant992008xid=934doff5 Accessed: 29 Nov 2018.
- Reiland R, Ralph. The Dirty Side of The War. The Humanist, Sep-Oct 2015. www.galegroup.com/apps/doc/a13581459/ovic?u=sant992008sid=bf18870b. Accessed: 29 Nov, 2018.
- The War on Drugs. The New York Times. 31 Dec 2017, www.nytimes.com/2017/31/opinion/failed-war-ondrugs.html. Accessed: 29 Nov 2018. Schutlz P, George and Aspe.
- Williams K, Michael. The War on Drugs is War on People. CNN, 22 Sep 2016, www.cnn.com/2016/09/22/opinions/war-on-drugs-michael-k-williams/index.html. Accessed: 29 Nov 2018.
Cite this page
War on Drugs In Modern World. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
The Atomic Bombings: were they Justified?
Atomic bombs have only been used twice in war. Both occurrences took place in Japan and were dropped by the United States. Being that the United States is the only country to employ atomic warfare and it has only occurred twice in history, it is often asked if these attacks were necessary and/or justified. Some may have found it difficult to view our leaders and the atomic bomb as a promoter for world peace and instead an uncontrollable weapon of war because of how harsh and cruel the bombings appeared (Stoff 159). Others strongly believed that Japan would have surrendered even if the bombs had not been dropped. Nonetheless, these atomic bombs were created and dropped for a purpose. There was no other weapon or type of attack that would have been more effective. The atomic bombs were absolutely necessary for America as they represented a step towards world peace and they saved plenty of American lives.
On August 6 of 1945, during WWII, the United States dropped a bomb on Hiroshima as an effort to end the war. This bomb, Little Boy, wiped out 90 percent of the city of Hiroshima killing around 80,000 people. Three days later, the United States dropped a second bomb, Fat Boy, on the city of Nagasaki. This bomb ended up killing about 40,000 people on August 9. Tens of thousands also died later in both cities in result of the effects of the nuclear bombs. Days later on August 15, 1945, Japan announced their surrounded, ultimately ending WWII (cbsnews.com).
In the building of the atomic bomb, they did not know exactly what they were creating. They began to see how rough, difficult, challenging, and unpredictable the job might turn out to be (Stoff 30). Nonetheless, going forward with bomb, they knew it was a delicate treasure that was sometimes referred as their master card. They did not take this weapon lightly and were unwilling to gamble with such big stakes in diplomacy (Stoff 91). Once the atomic bomb was built, they knew it was the only way to go end WWII. The initial intended use of the bomb was that it should be used against Japan as soon as possible; that it be used on a war plant surrounded by workers' homes; and that it be used without prior warning.
As time went by and people were studying the atomic bomb, it became clearer to them that dropping it was the way to go. The atomic bomb was strongly viewed as an act of world peace. Almost everyone knew that if the bomb attacks were performed quickly and successfully, it could determine the outcome of war. They knew that it must be controlled in order to assure future peace rather than be a menace to civilization (Stoff 106). The atomic bomb was not regarded as a new weapon but as a revolutionary change in the relations of man to the universe because they knew it would either doom or perfect the civilization (Stoff 121). The men knew that their weapon possessed a lot of power and their intent and obligation was to use that power with the best wisdom. The only objective with the bomb was military damage, not civilian lives. In result, the Nagasaki bomb was the trigger to the developments that led to peace.
No other weapon could potentially end the war. The military, at first, proposed to perform an open test in hopes of scared Japan and making them surrender. However, no one could suggest a way that was convincing enough that it would stop the war. If the demonstration was not to work the chance would be gone to do a surprise attack. Plus, experience with Japanese fighting men made it known that the war would not be stopped with just a demonstration. Lead scientists that studied the atomic bombs said that there was no way to end the war without direct usage.
Before dropping the atomic bombs, the men suggested an ultimatum to Japan. If Japan responded a surrender within two or three days, the bombs would not be dropped. The United States wanted to play completely fair as its position as a great humanitarian nation (Stoff 162). Leaflets were also dropped two days before bombing, warning Japanese civilians of what is to come, and few still responded. The United States sent out plenty of warnings before the atomic bomb dropped and they knew that it could cost half a million American lives to force the enemy's surrender on his home grounds (Stoff 223).
The main intent and purpose of the atomic bombs was to save American lives. Like mentioned, the bombs were made to damage military not civilians. Many emphasize that saving American lives by immediate military use will improve the international prospects (Stoff 150). The atomic bomb protects military lives by providing more and stronger protection. Some military men state, we've got to give these men the best weapons we can produce (Stoff 124). Without the use of atomic bombs, it can often lead to longer wars and the cost of human lives. The longer that war progresses, the smaller will our surpluses become, and the more our over-all resource will be strained (Stoff 185).
The atomic bomb was justified. It had strong intent and purpose that had a great outcome. When building the bomb, they knew the United States would be dominant if it worked. They treated the bomb not like a weapon but a like a diplomatic tool because they knew it can be used to assert U.S. dominance in political realm. They dropped this bomb because, if it worked, it would result in the shortening of war and the saving of American lives; it would bring us toward future peace by settling international disputes and this was all the ultimate goal. There was a reason we used the atomic bomb against Japan and many agree as a Gallup poll revealed that 85 percent of Americans approved of ?using the new atomic bomb on Japanese cities' (Stoff 253). When introducing the idea of the atomic bomb, there was plenty of doubt, but we carried on because we believed that its use will save the lives of American soldiers and bring more quickly to an end the horror of this war which the Japanese leaders deliberately started (Stoff 239). The actions of the atomic bomb attack on Hiroshima and Nagasaki were justified and I believe our military today should perform the same action when necessary.
Cite this page
The Atomic Bombings: Were They Justified?. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
The Atomic Bombing of Hiroshima and Nagasaki
During the final months of the second world war, the only two nation still at war were the United States and the empire of Japan. Both countries were suffering heavy casualties, and the United States decided to bring a swift and effective end to the war. On August 6th, 1945, the United States dropped the first atomic weapon used in combat, nicknamed the Little Boy, on the Japanese city of Hiroshima. Three days later, after no Japanese surrender, the United States dropped a second atomic bomb, nicknamed the Fat Man on the city of Nagasaki.
The bombs killed approximately 140,000 people and destroyed several square miles each upon their detonations, which brought the Japanese to finally surrender. Without the use of the bombs, it is highly possible that the war would have continued on for an unknown amount of time, resulting in an even higher death toll. Therefore, the atomic bombs dropped on Hiroshima and Nagasaki were entirely necessary in order to bring World War Two to an end.
The United States began the development of atomic weaponry after discovering German scientists were attempting to split the atom and release the energy that held it together. This process is known as nuclear fission, and is the reason an atomic bomb can do the amount of destruction that it does. President Franklin D. Roosevelt established the Manhattan Project on December 28th, 1942, which brought together important scientists to research and develop a nuclear weapon before Germany could. The first atomic bomb, nicknamed Gadget, was tested on July 16th, 1945 in the deserts of Alamogordo, New Mexico. This became known as the Trinity test. The bomb exploded with the force of approximately 18 kilotons of TNT.
Originally, the United States planned to threaten Germany with the atomic bombs. However, once Germany surrendered to the Allies on May 7th, 1945, the only country still at war was Japan. In July of 1945, President Harry S Truman issued the Potsdam Declaration, which warned the Japanese empire to surrender or face prompt and utter destruction. After ignoring the declaration, the United States decided to use the atom bombs they had developed. After dropping the bombs, Emperor Hirohito and his advisors finally decided to surrender to the United States on August 15th, 1945, marking the end of the second world war.
Without the usage of the atomic bombs in Japan, it is very likely that the casualties may have been drastically higher than those of the bombings. Karl T. Compton was a physicist during World War Two that was involved with many scientific projects, including heading the D Division of the National Defense Research Committee, which researched detection technologies, which included radar, fire control and heat radiation. Compton went on to become the scientific advisor to General Douglas MacArthur. After studying the atomic bombing, Compton came to the conclusion that it was entirely necessary for the United States to drop the atom bombs on Hiroshima and Japan. In his letter to President Truman, titled If the Atomic Bomb Had Not Been Used, Compton begins by interviewing a Japanese Army officer. The officer told Compton that if the bombs had not been dropped and a land invasion (which was the planned alternative to the atomic bombs) had happened, the Japanese army would have continued to fight until all Japanese were killed,but we would not have been defeated.
The officer explains that the Japanese people consider surrendering to the enemy extremely disgraceful, and that they would much rather die than need to surrender. This was the reason that the Japanese continued to fight, despite losing Germany and Italy as allies in the months leading up to the atomic bombings. This gave Compton reason to believe that the atomic bombs actually saved the lives of thousands of Americans and Japanese, and that they were the only reason World War Two ended as quickly as it did. Compton then provides Truman with information that proves that the bombs were not the deadliest attack on Japan. During the B-29 incendiary raids over Tokyo, an estimated 225,000 people were killed in total, a much higher rate of casualties than that of the atom bombs. The Tokyo air raids also destroyed approximately 85 square miles of city, whereas the atomic bombing of Hiroshima only destroyed about 5 square miles, a drastically smaller amount of damage.
After comparing the Tokyo incendiary raids with the atomic bombs, Compton returns to the idea of a beach invasion in Japan. According to General MacArthur's staff, an invasion of Japan would result in approximately 50,000 American casualties and several times that number of Japanese casualties. It was highly likely that the Japanese would defend their homeland much more forcefully than when the United States invaded Iwo Jima and Okinawa. General MacArthur goes on to talk about how if the Japanese government was overthrown and lost all control over its people, soldiers may result to guerilla warfare in the Japanese Alps, which gave way to the possibility of the war lasting for up to a decade longer. Another argument that Compton makes is that many of the Japanese citizens did not want to surrender.
Cite this page
The Atomic Bombing Of Hiroshima And Nagasaki. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Was a Bomb on Japan an only Solution?
There have been many debates on whether or not the united states were justified on dropping the Atomic Bomb on Japan; was it absolutely necessary to take lives of thousands of people, or was this just an easy way out of the war? In this paper I will cover the following reasonings on why I do not think the dropping of the atomic bomb was justified. The first reason I will be using to defend my argument is that Japan had no allies. Next, I will discuss how many lives were lost because of this tragic decision and lastly, I will discuss how I feel it was an irrational decision on the US governments part.
Had Japan had other allies helping them in this war I could possibly see this bombing being justified but they were fighting this war alone. It is also said that Japan was on the verge of surrendering. According to The Decision To Use The Atomic Bomb it is stated that The justification for using the atomic bomb was that it had ended the war, or at least ended it sooner and thereby saved countless American and Japanese lives. But had it? Had not Japan already been defeated and was she not already on the verge of surrender(Louis Morton, pg. 334)
I could see the reasoning on wanting to end the war to save American lives; but to say it was to save Japanese lives as well is ridiculous in my opinion. I strongly feel if they had knowledge that Japan was on the verge of surrendering, they could have avoided loss of Japanese lives by allowing them to surrender. This does not mean that no more American lives would be lost because that is never guaranteed, but thousands of lives that were lost could have been avoided had they given Japan a little more time to surrender. I feel the United States was proud of what they created and just wanted to make an example out of Japan so that in the future any time the United States went to war with another country that country would think twice before crossing the United States because they would know what the US was capable of.
Numerous lives were taken as well as injured by the A-bomb dropped on Japan. According to an online article on UCLA www.aasc.ucla.edu titled Hiroshima and Nagasaki Death Toll. It is not unlikely that the estimates of killed and wounded in Hiroshima (150,000) and Nagasaki (75,000) are over conservative. Many of the bodies injured by the blast were scattered what is said to be considerable distances. Not only were soldiers fighting with Japan died from this nuclear bomb died but this atomic bomb also claimed the lives of many innocent men, women and children. It is said in an article in the Atomic Heritage Foundation website that The bomb was known as "Little Boy", a uranium gun-type bomb that exploded with about thirteen kilotons of force. At the time of the bombing, Hiroshima was home to 280,000-290,000 civilians as well as 43,000 soldiers. Between 90,000 and 166,000 people are believed to have died from the bomb in the four-month period following the explosion.
The U.S. Department of Energy has estimated that after five years there were perhaps 200,000 or more fatalities as a result of the bombing, while the city of Hiroshima has estimated that 237,000 people were killed directly or indirectly by the bomb's effects, including burns, radiation sickness, and cancer.( Curtis LeMay, Paul Tibbets). This is an extreme amount of deaths for innocent civilians. For someone who is willing to fight for their country or who has been drafted to do the task of fighting in a war this would be no issue. However, I don't feel like innocent people should die because of a current war the country they reside in is in the middle of war. In my opinion this could be viewed as a terrorist attack. In which the people from that country have nothing to do with what is going on but because they are citizens of that country they lose their right to live because their government is at war. Sadly, an example of this is the attack of 9/11, those people shouldn't have died they were innocent in all of it. Our government could have possibly avoided the situation had our president during that time, George Bush, payed more attention to the threats being made by Osama Bin Laden and his people. I know when a country is at war with another country it is inevitable for lives to be lost even those of innocent people; however, there are instances when lives lost could be minimized. The amount of lives that were lost because of the dropping of the atomic bomb is absolutely horrible.
I think many people could agree with me when I say this was a situation that could have been avoided and it was extremely irresponsible of our government to drop these atomic bombs. As previously mentioned, there were many lives lost and that blood is on our hands as Americans. In The Decision to Use the Atomic Bomb It is also mentioned that During the early days of the project one scientist recalled we spent little time thinking about the possible effects of the bomb we were trying to make (Louis Morton, Pg.335) If that isn't doesn't seems irresponsible to our government, we should rethink our leaders and what they represent. This atomic weapon was never entered into deliberations of strategic planners It was said Admiral Williams Leahy. The best kept secret of the entire war and only a handful of the top civilian and military officials in Washington knew about the bomb (Louis Morton Pg. 335). If the government can keep something like that from its people are, they really for the people. I guess one could argue that they government was thinking about the best interest of our Country, but there was probably a better method they could have taken for this situation. I understand why a secret like this needs to be kept silent because of all the chaos it would cause because different people have different opinions so I can understand that. I just strongly feel more thought could have gone into this decision prior to the action being taken.
In this paper I have given three reasons why I feel the United States was not justified in their decision on the dropping of the atomic bomb. Japan was fighting this battle on their own with no help from any other country, they couldn't rely on someone to come to their aid an assist them with the task. There were way too many lives taken in this process including woman, children, elderly. Lastly it was extremely irresponsible of our government to drop a nuclear bomb of this sort when there were other choices to be made. I love the country I live in and I am proud to be an American. I have a very high level of respect for out military. The choices our government made before my time is something that cannot be changed. Those choices have also allowed us to become the great country we are today. Regardless of the race wars that are going on and all of the problems in today's society this country definitely comes together when it is most needed. I love this country and what we stand for even if I don't always agree with our politics and what our president is and isn't doing. I wouldn't want to live anywhere else.
Cite this page
Was A Bomb On Japan An Only Solution?. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
The Atomic Bomb: how it Protected
Trinity, a graphic history of the first atomic bomb, is written by Jonathan Fetter-Vorm and describes the detailed process of how the atomic bomb was created and how it was used against Japan in the second World War. Theodore Van Kirk was the navigator on the plane that dropped the first atomic bomb on Hiroshima. In an interview, he was asked to describe his mission, the time leading up to it, and his perspective on dropping the bomb. It is seen from both authors that protecting American citizens and soldiers was the top priority, as well as ending the war. Fetter-Vorm uses the trope, protection, to argue that the bomb was the safest way to accomplish their main goal: to end the war. United States' leaders and army generals hoped to lessen the total number of casualties from the war. Similarly, Van Kirk uses protection as his trope to argue the bomb was the best way to quickly end the war. It is important to look at how both authors utilize the trope in order to prove that using the atomic bomb was the ideal option to effectively end the war and save the lives of Americans.
In Trinity, Henry Stimson, the Secretary of War, argues that the war would become more violent if Japan was invaded, and this is significant because it shows the bomb was the better choice for ending the war. During a meeting, Stimson said, If America invades Japan, we will have to go through an even more bitter finish fight than we did in Germany (83). The general wanted to protect the soldiers that would be shipped out to Japan. Dropping the bomb meant that Japan would not have to be invaded, which also meant that there would be less American casualties. In the interview with Van Kirk, he explains that dropping the atomic bomb would save both Japanese and American lives, which is significant because this also shows that lessening the impending number of casualties was important to military leaders. Van Kirk believed that the number of casualties would have been much higher for both the United States and Japan if they had chosen to invade Japan instead of dropping the bomb. Though the bomb resulted in mass Japanese casualties, both sources illustrate that the result of an invasion would have been much worse for the countries involved.
Soldiers were depicted in Trinity as restless before their mission, as they laid awake thinking about the possibility of being seen as heroes. This is significant, because they believed they were going to end the war. They believed this was in the best interest of Americans, because they were protecting them from the Japanese. In the same way, Van Kirk describes himself and his fellow airmen as not being able to go to sleep, because they were wondering if the bomb was actually going to work. It is significant, because they wanted the atomic bomb to work in order to ultimately save lives and bring the war to an end. Both Van Kirk and the soldiers from Trinity felt this was their only option to end the war. In contrast to Trinity, Van Kirk and the others on his mission team were not thinking about being seen on television or wondering if they would be considered heroes by their neighbors. They were not looking for recognition; they just wanted to serve their country. Overall, protection was conveyed by both parties, as they wanted to end the war and save as many American lives as possible.
During the interview, Van Kirk describing how the Japanese were not good people back then is significant because it was a way of condoning killing the Japanese [7:03]. Though he did not admit it, this potentially could have been Van Kirk's way of killing any remorse he felt from killing so many Japanese civilians. By dropping the bomb, the United States would subdue the people of Japan, thereby saving American lives. In the Trinity, General Curtis LeMay rhetorically questions if it is better to have dead Japanese or dead Americans, and this is significant because it illustrates how the safety of Americans was prioritized. He was looking out for his soldiers' best interests, as well as those of United States citizens. Both LeMay and Van Kirk would agree that Japan was the enemy, so protecting Americans was more important than worrying about the number of casualties Japan was going to accumulate.
In the book, the Japanese had to decide if they should surrender to the United States, and this is significant because they had to think about the safety of their citizens. On the fifteenth of August, the emperor of Japan surrendered by stating, Should we continue to fight, it would not only result in an ultimate collapse of the Japanese nation, but also it would lead to the total extinction of human civilization... (131). Japanese leaders had considered the effects of continuing the war, but they recognized that the safety of their citizens was in jeopardy. They did not want their race to become extinct. In the interview, Van Kirk discussing the many casualties of war and how he knew several prisoners of war is significant, because it explains why he felt the bomb was needed. He was willing to do whatever it took to end the war. Like the Japanese, Van Kirk did not want there to be any more casualties.
In the graphic novel Trinity and the interview with Air Force navigator Theodore Van Kirk, the theme of protection through the use of the atomic bomb was displayed in various ways. It is conveyed by both sources that saving American lives and ending the war was the top priority. The atomic bomb effectively brought the war to an end, resulting in many innocent Japanese lives being taken. Fetter-Vorm uses protection to argue that the bomb was the safest way to end the war. Likewise, Van Kirk uses protection to argue that the bomb was the most effective way to end the war. Both authors utilize the trope, protection, to prove that using the atomic bomb was the best way to end the war.
Cite this page
The Atomic Bomb: How It Protected. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
A Horror of the Atomic Bomb
How could a bomb wipe out five-square miles of buildings and kill tens of thousands of people? The Atomic Bomb or nuclear bombs are powerful weapons that use nuclear reactions as their source of explosive energy. Atomic bombs have been used only twice”both times by the United States against Japan at the end of World War II. The Atomic Bomb to date is the deadliest weapon to be discovered so far. When the Japanese Combined Fleet bombed Pearl Harbor, which brought the United States into World War II, the United States then took approximately four years to create the atomic bomb and disintegrate two of Japans major cities near the end of World War II.
When Admiral Isoroku Yamamoto and his combined fleet bombed Pearl Harbor; it had dealt great amounts of damage to the harbor and killed a couple thousands of citizens. Of course, the most important consequence of the attack on Pearl Harbor was the American declaration of war against Japan. While this was expected, Japan thought the US would be entering the war with a crippled and broken navy. Despite the efforts of the bombing runs on December 7th, the United States Navy wasn't nearly as hindered as it was meant to be. (The Consequences).
After the bombing on Pearl Harbor, the United States began experimenting with numerous weapons to fire back at Japan. The United States then found a weapon that could wipe out a city or a population. Japan's attack on pearl harbor led us to make the deadliest weapon on earth, the Atomic Bomb. By drawing the United States into World War II” Awaking the Sleeping Giant,”the Japanese engaged a formidable foe that eventually led to their total defeat in 1945. (The Consequences). After the Japanese Fleet bombed Pearl Harbor; President Franklin Delano Roosevelt signed the official declaration war on Japan. The United States had then tested with numerous elements in secrecy of the public in Alamogordo, New Mexico; the U.S. finally set off the very first test of the Atomic Bomb. The question now became”on whom was the bomb to be dropped? Germany was the original target, but the Germans had already surrendered. The only belligerent remaining was Japan. (History.com Editors). The United States was ready to show Japan what the U.S. as really made of. The next target was the two major cities of Japan.
The Atomic Bomb is the harshest weapon known to man that could eliminate a city full of buildings and citizens. After the bombing of Pearl Harbor, the U.S. finally entered the war with the strongest navy fleet and weapons that any country has ever seen. Finally, on the morning of July 16, in the New Mexico desert120 miles south of Santa Fe, the first atomic bomb was detonated. The scientists and a few dignitaries had removed themselves 10,000 yards away to observe as the first mushroom cloud of searing light stretched 40,000 feet into the air and generated the destructive power of 15,000 to 20,000 tons of TNT. The tower on which the bomb sat when detonated was vaporized (History.com Editors). The Atomic Bomb weighed at least 9,000-10,000 pounds since the weapon made smoke arise 40,000 feet into the air and had to pack a punch that felt like 15,000-20,000 tons of dynamite.
The Atomic Bomb had to be made from a fissile element, which is material capable of sustaining a nuclear fission chain reaction. such as Uranium or Plutonium. The tower it was on, had to be made from numerous pieces of steel to support the weight of the bomb, but it was vanished into thin air after the nuke was detonated. In the battles, in which they used the Atomic Bombs, they dropped them using colossal size parachutes. The U.S. then knew that instead of the United States citizens being afraid of Japan; that Japan should now be afraid of the U.S. They harness the forces that hold the nucleus of an atom together by using the energy released when the particles of the nucleus (neutrons and protons) are either split or merged. (How do nuclear weapons work?). An Atomic Bomb takes the purest energy there is, which is the theory of splitting an atom, and the bomb holds all the pressure inside its shell until it hits the ground and causes a mushroom shaped cloud to appear. When the nuke detonates; there is a great deal off heat that rapidly gets hotter and less dense because of the surrounding air. When the smoke, debris, and heat reach at a certain distance in the air; a vacuum type reaction happens and all the air that is surrounding the fireball of intimate death then goes inside the fireball and pushes out the debris and heat causing a mushroom cloud.
On August 6, 1945, during World War II (1939-45), an American B-29 bomber dropped the world's first deployed atomic bomb over the Japanese city of Hiroshima. The explosion wiped out 90 percent of the city and immediately killed 80,000 people; tens of thousands more would later die of radiation exposure. Three days later, a second B-29 dropped another A-bomb on Nagasaki, killing an estimated 40,000 people. Japan's Emperor Hirohito announced his country's unconditional surrender in World War II in a radio address on August 15, citing the devastating power of a new and most cruel bomb.'. (History.com Editors). Hiroshima is a city that is 130 square miles large, and just a bomb wiped out 90% of just that one major city. The Japanese Emperor did not know that the U.S. had another bomb that could eliminate that much of a city. The bombs killed over 100,000 people in less than a week, and more then 30,000 more over the course of the next few years because of radiation exposure. the more than 9,000-pound uranium-235 bomb was loaded aboard a modified B-29 bomber...The plane dropped the bomb“known as Little Boy . it exploded 2,000 feet above Hiroshima in a blast equal to 12-15,000 tons of TNT, (History.com Editors). The bomb had to be carried by a specially created airplane that could do two things, which was to make sure the bomb stays still throughout the flight from start to finish and could handle the amount of weight that was put into the airplane. If the plane was not modified; then the pilot would have probably died when the plane fell from the sky because the bomb weighed a ton. Or the airplane would have hit slight turbulence and make the bomb hit the side of the plane, and then the bomb goes off in the cargo area.
This bomb was made with a very rare element, which would later cause mass destruction to one of Japans manufacturing center with approximately 300,000 people in the city. The bomb was very heavy because it was full of uranium, so that the chain reaction would not only stop at one of the element particles but keep on reacting with other fissile particles in the atomic bomb. Hiroshima's devastation failed to elicit immediate Japanese surrender..., drove Sweeney to a secondary target, Nagasaki, where the plutonium bomb Fat Man....More powerful than the one used at Hiroshima, the bomb weighed nearly 10,000 pounds and was built to produce a 22-kiloton blast.... Nagasaki, which was nestled in narrow valleys between mountains, reduced the bomb's effect, limiting the destruction to 2.6 square miles. (History.com Editors). The bomb that was dropped on Nagasaki was a much wider and heavier bomb than the one dropped on Hiroshima. The reason being is because the U.S. wanted to show the Emperor that the Japanese imperial army needed to surrender, or the United States would keep dropping the new and most cruel bomb.
The Atomic Bomb that was dropped on Nagasaki was made from plutonium, and one particle of plutonium is a little bit heavier but does a lot more damage to a target. When the new and improved plutonium Atomic Bomb hit the Nagasaki area the U.S. had thought it would throw debris in all direction, but since the bomb hit between two mountains the debris had just imbedded itself into the side of the mountain. The Atomic Bomb had done great damage to both cities in Japan, and with the newly and updated research on the Atomic Bomb; we now have approximately 4,000 nuclear warheads ready to be deployed on any opposing forces that threaten the U.S. the United states also has the second biggest stockpile of nuclear warheads in 2018.
The Atomic Bomb are weapons of mass destruction that if a country had enough it could wipe out an entire country in just a few hours. The Bombs have a special element inside the shell called a Fissile element, which uses nuclear reactions as their source of explosive energy. These bombs have only been used twice, and both were used three days apart by the United States against Japan. They used these bombs as a consequence of the Japanese Combined Fleet Bombing Pearl Harbor in 1941. The Atomic Bomb was the deadliest weapon to use and certainly the most expensive in World War II. After Japan bombed Pearl Harbor, the U.S. then took four years to create the deadliest weapon to man also known as the Atomic Bomb. Which country would be next to feel Americas wrath?
Cite this page
A Horror Of The Atomic Bomb. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Ancient Egyptian Hieroglyphs and Art
The Egyptian culture dates all the way back to 3000 BC with its widely known invention of hieroglyphics. Egyptians were inspired by art, that was based off religion. Every piece of art sculpture or paintings that was constructed by the Egyptians related some type of story, these stories were told through writing on tombs, walls, obelisks, pyramids, and papyrus. The Egyptians strongly believed in having a polytheistic belief which is the belief in many gods.
The history of hieroglyphics goes back to 3200-3000 BCE. Hieroglyphics is a way of communications used by the ancient Egyptians. It was like English, Spanish, French and many other languages that we have today. It was a form of writing that the Egyptians learned to be able to communicate between each other. Just like today how English represents your culture and where you are from, that is what Hieroglyphics did. The Hieroglyphics represented their language and culture. The Hieroglyphics weren't like letters that we have in language you know today; they were pictures that meant different things. It can be related to like the Chinese writing, a lot of lines. Because of their pictorial elegance, Herodotus and other important Greeks believed that Egyptian hieroglyphs were something sacred, so they referred to them as 'holy writing (Scoville, Priscila. Egyptian Hieroglyphs.). That is another reason that they have named it Hieroglyphics, it stands for holy writing. Similar to the Alphabet where each letter has a sound, and when you're learning the alphabet you can put an image to it, that's what the Egyptians did with their script. The script was composed of three basic types of signs: logograms, representing words; phonograms, representing sounds; and determinatives, placed at the end of the word to help clarify its meaning. (Scoville, Priscila. Egyptian Hieroglyphs.). Each picture meant something which is why the English language is not much different from the Egyptian language. Egyptian scribes used papyrus and other alternative writing surfaces, including writing boards generally made of wood. (Scoville, Priscila. Egyptian Hieroglyphs.). Papyrus was a form of plant that they were able to write on much like our paper that we have today, they also wrote on bones.
The Egyptians had numerous amounts of art that they had made over the years that we have discovered in this time period. Art was very important to the Egyptians culture; art is a big part of any culture. Every time period had some form of art that made history and is still talked about today. The Egyptian art was based around the thought of Gods. Much like how the Greeks had their Gods and Goddesses the Egyptians art was based off the idea of Gods as well. No matter how beautifully a statue may have been crafted, its purpose was to serve as a home for a spirit or a god. (Mark, Joshua J. A Brief History of Egyptian Art.). Their art was a form of showing that this is a representation of a God, of a super natural being that would help them out it ways they needed help in. Some forms that they made their art into was tomb paints, temples, palaces, paintings, and sculptures. There were thousands of pieces of art over the years they had made. Most of the tombs that were made were for the kings. They would paint on the walls of the tomb to represent all their accomplishments in life. Understanding the Egyptian art is difficult to understand being we don't know their language very well. Their art work is very much appreciated; the art has a lot of meaning behind them. There are paintings that still today you learn about. One that I remember learning is the mummification. It is a picture of someone who has died and them paying their respect to them. Every piece of art that was made had a reason behind it.
This painting is important to their history of art because it shows what happened to the dead. Mummification was a big part of Egyptian history. When people died they got put in tombs and had a ceremony for them. So this painting shows and represents what happened when you died. Another one that can recall is the painting that was the battle of Nubia. It showed their history of the wars they went through. This painting shows that they defeated Nubia and expanded their land which was a big part of their history. Just like all of our wars that are painted represent our history. The difference between their art and the art that we have today is that theirs was never meant to be seen. Much of the Egyptian art was meant to be represent the death of their people. Almost all of their art is full of text, most of their art showed a sense of civilization and unity within their culture. It is for this reason that Egyptian temples, palaces, homes and gardens, statuary and paintings, signet rings and amulets were all created with balance in mind and all reflect the value of symmetry. (Mark, Joshua J. A Brief History of Egyptian Art.). Their other form of art was through temples that they hand crafted to represent their culture and the belief of the Gods. Early temples were constructed on sites which the people felt had a numinous quality to them which indicated the presence of a god, gods, or spirits. (Mark, Joshua J. A Brief History of Egyptian Art.).
The Egyptians first settled near the Nile river To the ancient Egyptians themselves, their country was simply known as Kemet which means 'Black Land' so named for the rich, dark soil along the Nile River where the first settlements began. (Mark, Joshua J. A Brief History of Egyptian Art.). The Egyptians were very advanced to say the least. Egypt thrived for thousands of years (from c. 8000 BCE to c. 30 BCE) as an independent nation whose culture was famous for great cultural advances in every area of human knowledge, from the arts to science to technology and religion. (Mark, Joshua J. A Brief History of Egyptian Art.). the Egyptians managed to do death in a different way. Instead of mourning the death of friends and family members they in a way celebrated them. By writing on their tombs and giving them a ceremony. As earlier stated they wrote on the tombs what the dead had accomplished in their life time. They also were very advanced in knowledge of a higher power. They believed in a form of a God much like some people do today. They believed that there was an afterlife in a way. At death, one would meet with judgment in the Hall of Truth and, if justified, would move on to an eternal paradise known as The Field of Reeds which was a mirror image of one's life on earth. (Mark, Joshua J. A Brief History of Egyptian Art.). They had strong beliefs in Gods and Goddesses and were very religious. Their art work, history and religious belief is very interesting too know about.
The Egyptian's were very advanced in many areas; a lot more than previous eras have been. The art work that they made and kept up with is very advanced compared to others. The language they came up with is amazingly unique and complex. Since they were intensely religious and believed in higher power. Their everyday life revolved around a higher power. Much like today were we serve a higher power they did the same thing. If the Gods, they believed in every helped them out in any way they would praise them. They went years being extremely lucky with their way of life. They gave credit to all their success to the Gods. Their ruler Pharaoh had a lot to do with their success in their culture. Even though their culture was extremely rich and deep. For them being settled on the Nile river gave them an advanced help to fresh water which helped them with their farming. It made the soil incredibly rich for farming which is a big part of their culture. The biggest part of their culture is there art. Their art showed many stories, such as tall tales like we have. They even wrote about events that had taken place during their time period. This is another reason we know so much about their culture. They were very good at writing down what had happened which helps with knowing about their history. It helps us understand their art work, religion, and how their everyday life was here on earth. What we have learned from them is that we have the same traits that they had. Were more advanced than they were but we learned a lot of our traits from them. Such as religion, art, and our language.
Work cited
Mark, Joshua J. A Brief History of Egyptian Art. Ancient History Encyclopedia, Ancient History Encyclopedia, 26 Nov. 2018, www.ancient.eu/article/1077/a-brief-history-of-egyptian-art/.
Scoville, Priscila. Egyptian Hieroglyphs. Ancient History Encyclopedia, Ancient History Encyclopedia, 24 Nov. 2018, www.ancient.eu/Eg
Cite this page
Ancient Egyptian Hieroglyphs and Art. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Nelson Mandela and South Africa
Have you ever heard of South Africa and how Nelson brought apartheid to an end? Well if you didn’t today is your lucky day, because I will tell you every little thing that I know about South Africa and what happened there. South Africa is one of the most geographical countries in the African Continent. It is located in the Southern tip of Africa, It is also along the Atlantic and the Indian Ocean. South Africa’s climate is hot and comfortable.
Rolihlahla Mandela was borned in the Madiba Clan in the village of Mvezo on July 18, 1918. He attended primary school in Qunu where his teacher, Miss Mdingane, gave him the name Nelson. Hearing the older people stories and what they were famous for, Nelson wanted to be famous for something too. Mandela wanted people be together and be a family, no matter what color you are.
Nelson joined the African National Congress in 1944 to help establish the African National Congress Youth League. The ANC adopted a more radical mass-based policy, the Programme of Action, in 1949. White people in South Africa were very racist with black people in the olden days but Nelson Mandela, and his team ended all the racism in South Africa,which is now called Apartheid. Nelson Mandela's role in bringing apartheid to an end was very important to Black People.
In 1952 he was chosen as the National Volunteer-in-Chief of the Defiance Campaign. He went to jail from 1962 to 1990 (27 years), during that time he had become an international symbol for the anti-apartheid movement. As soon as he got out from jail (1990), he went back to his speeches and meetings in South Africa. Mandela was elected the first black President in 1994 through 1999. Nelson Mandela and the anti-apartheid movement gained international support as there were worldwide protests and sanctions against the apartheid government. Nelson Mandela sadly died on December 5, 2013.
South Africa has one of the world’s worst education systems, it is 75 out of 76 in the world. Unfortunately, after apartheid ended South Africa’s maths and science education comes in last place. This is due to some of the unhealed wounds of apartheid. The country is trying to innovatively improve its educational system. In light of this educational struggle, some type of educational reformation must come about.
Housing is one of the biggest problems facing South Africa. Even though many South Africans have access to low cost housing from the government, findings show that most of the housing problems are caused by corruption and mismanagement. This is because South Africans don’t have a lot of money to pay for things in their country. South Africa’s lights in the houses cut off sometimes due to them not having a lot of money.
The government of South Africa is ramping up efforts to get more land into black ownership because white people bought most of the land in Africa. White people own 72 percent of South Africa's land and black South Africans, who make up 80 percent of the population, own just 4 percent. This is not fair because it is being selfish and racist to black people.
White people earn more money in South Africa then black people because white people are trying to be racist. This is why white people buy more stuff and have more beautiful houses then black people. South Africa is the world’s most unequal country.
White people are still racist after apartheid but not really as racist like they were before apartheid because the ANC ended apartheid. White people cannot hit black people anymore, if they do they would go to jail (it is illegal).
The white employees treat the black employees wrong because they are trying to act like south africa belong to them.
The ANC is still helping black people out, the only difference is that mandela is not there.
Music plays a big role in South Africa, people in Africa love music because it make them happy and turn into a good mood. If singing in a choir could lead to you being stronger and happier , then singing in South Africa will too. Singing in different sections adds great value to your life because you will have more faith in yourself.
Music make people feel a type mood. The words in the songs are very important because it basically tells you what the singer is talking about. The beats are important too, because if there are no beats then the song would be weird. Another thing that is important is articulation because you need to know what the singer is saying.
Cite this page
Nelson Mandela and South Africa. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Ancient Egyptian Boats
The Nile in Ancient Egypt was practically everything to them. They didn’t have to use extra resources for roads. Instead, they built boats and traveled the Nile (Nelson, 2018). Boats were so important they also made their way into many different aspects of Egyptian mythology.
The first boats were made of papyrus reeds and held together by rope made of papyrus (Ganeri, 1999). When they went north, they used oars because that is the way the Nile flows. As time went on and they needed to travel South, they made sails to harness the wind and built wooden boats to better support the sails (Nelson, 2018). They didn’t use nails because they were invented until the 1600’s and weren’t mass produced until the 1800’s (Visser).
Around 1100 B.C., Ancient Egypt was attacked from the mouth of the Nile by the Sea Peoples. King Ramesses III built warships and sent them out to defend Egypt (Ganeri 1999). The way that they succeeded was all because they had both oars and sails and they could maneuver a lot better. The Sea People only had ships with sails (Ganeri, 1999).
The wooden boats were made with acacia, found in Egypt, or cedar wood from Lebanon (Nelson, 2018). They were more powerful than the papyrus boats. These boats made of wood were also the most popular funeral boats for the rich (Ganeri, 1999). Boats played a big part in Egyptian mythology Egyptians believed that the souls of the dead got ferried into the underworld by boat (Ganeri, 1999). They believed that Ra the sun god, or the sun itself, rode a boat through the sky and at night rode through the underworld (Nelson, 2018). Most Ancient Egyptians were buried with tiny models of boats to help their soul travel to the underworld. King Tut was buried with 35 different boats (Nelson, 2018).
Regardless of their everyday importance, most of their boats did not survive. A lot of the research is based on drawings and religious works. There were only a handful of wooden boats that were discovered and studied (Nelson, 2018). Imagine the time it took to make all of Tut’s boat’s.
In conclusion, the Nile River was the main way the Ancient Egyptians did anything. Because of this, boats were the main mode of transportation. They were known to carry all kinds of stuff from food to funerals. They were even used to explain where they went when they died and how the sun traveled through the sky. These boats kept Ancient Egypt together, but the only thing holding the boats together were rope and papyrus reeds.
Cite this page
Ancient Egyptian Boats. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
The Ancient Egyptian Sarcophagus
A coffin that was made to hold a body for all eternity. Made over 3,000 years ago, the Ancient Egyptian Sarcophagus was a major step in this great country's incredible civilization.
The Sarcophagus had many important uses. The main purpose of these coffins, were to protect The body from animals, and tomb robbers. It also kept the body from deteriorating. This was vital, because the Egyptians believed that the body was needed in the afterlife. Without a body, your chance at the afterlife was ruined permanently. Pointed out to many, this was no ordinary box.
Over time, Sarcophagi were made of many different things. Sarcophagi were made of black, or green basalt, quartz, marble, limestone, and wood. In rare cases, including King Tutankhamen, sarcophagi were made of solid gold! A usual feature to Sarcophagi, were designs decorations with gold, pottery, and other fine elements. In addition to these special Egyptian coffins, werehuman shaped carvings of the inhabitants physical appearance. (Curved noses, pierced ears, excetera) These were best materials,to show respect to the dead.
The Egyptian Sarcophagus was first made long ago. The very first Egyptian Sarcophagus was made of stone in the 3rd dynasty. Next, in the 11th dynasty, the first box-like wooden sarcophagus was made. Finally, in the 17th dynasty, the first sarcophagus with a human shape was created. In later years, nesting layers of sarcophagi were created. (Putting a sarcophagus, inside a sarcophagus, inside a sarcophagus) These creations marveled many, showing the Egyptians incredible craftsmanship.
Many things were needed in the afterlife. The Egyptians believed that the body, and the soul were needed to move on to the afterlife. They believed that the afterlife was a new life, and in it, you would be reborn. This is why the Egyptians went to so much trouble to preserve their dead. Other things, including food, water, clothing were also buried with the sarcophagus, to be used in the afterlife. These were all need to make the extensive journey to the afterlife.
The Ancient Egyptian Sarcophagus had many cool, and fun facts. The wordSarcophagus, comes from the Greek words sarx meaning flesh, andphagein meaning eater. Sarcophagi were often decorated with important scenes from a person's life, including battle, or marriage scenes from the person's life. The oldest ever piece of cheese, was found buried with an important Mayor named Ptahmes! The Eye of Horus, (a well known Egyptian symbol) was painted on the side of most Sarcophagi, so that the person inside could see out! It is incredible that a coffin could be so amazing!
In conclusion, the Egyptian Sarcophagus was useful, a very important factor to get to the afterlife, and an incredible invention.
Cite this page
The Ancient Egyptian Sarcophagus. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Heliopolis Creation Story
At first, there was nothing in the world but a vast ocean of chaos, which was named Nu. There was nothing in the world except Nu. There was no sky, no land, no up, no down, nothing. Using his pure thoughts and force of his will, Atum came to be. Atum was the first of the primordial Egyptian gods. He created a hill because there was nowhere he could stand. Now there was only Nu and Atum in the world. Atum was lonely, so he joined with his shadow to produce a son and daughter. He named his son Shu and made him the god of the air. He named his daughter Tefnut and made her the goddess of mist and moisture. Shu and Tefnut married and gave birth to Geb and Nut.
At first, they were tangled together, so Shu pushed Nut up into the heavens. Nut became the sky goddess and Geb the earth god. They were destined to be together, but they had to be separate to fulfill their functions as the earth and sky. Nut and Geb gave birth to Isis, Hathor, Osiris, Set, Thoth, and Nephthys. One day Shu and Tefnut got lost in the waters of Nu. At this time Atum had only one eye. He sent it to search for Shu and Tefnut. While the eye was out looking for his children, Atum fashioned himself a new eye. When the eye returned with his kids, Atum wept tears of joy. When the tears hit the ground, they became the first men.
Worship and Pharaohs
The Egyptians believed that they should worship the gods. They offered sacrifices, pleasing the gods. Sometimes, they would offer sacrifices for things like keeping their temples and pyramids safe. The pharaohs (the rulers of a part of Egypt) were said to have divine powers, so citizens worshipped the gods and the pharaohs.
Around 3000 BC, a man named Narmer united the upper and lower halves of Egypt. He became a ruler of all of a\Ancient Egypt, the first true pharaoh.
Cite this page
Heliopolis Creation Story. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
What is the Influence of Aerobic Dance on Cognitive Performance in Adults with Schizophrenia?
A quasi-experimental matched- control design was used to examine the effects of aerobic dance intervention on the cognitive functions of people with schizophrenia. All participants were volunteers, and after a detailed explanation of the study procedures, written consent forms were obtained from them. The participants had to be between the ages of 20- 60 years old, their diagnosis of schizophrenia had to be made by a psychiatrist, been diagnosed for at least 2 years, stable psychiatric condition, score higher than a 24 on a mini- mental state examination, speak in mandarin or Taiwanese, and be willing to participate in an exercise program. The intervention was led by two senior occupational therapists and was held 3 times a week for 3 months. Each session was a total of 50-60 minutes (5 minute warm up, 40 minutes of aerobic dance, 5 minute break, and a 10 minute cool down). They monitored the participant's heart rates using a radial pulse measurement before and after the program. The program was choreographed with simple and easy to teach movements that used both upper and lower body. The movements were designed to be similar to movements that the participants would be familiar with such as wiping windows, washing clothes, and swimming. They recorded the attendance and they used an incentive such as a water bottle or towel to give to each participant who did not miss any sessions for that month. A informational meeting was held every month to continue to promote the benefits of regular exercise and motivate the participants to finish the program. The control group took part in coloring and handwriting activities while the intervention group was in their aerobic class. The control group had the same schedule as the intervention group, but the control group did not have monthly meetings.
What Did They Find (Findings, Results)?
There were 4 different tests that were conducted to test for improvements the Symbol Digit Modallist test, the Rey Auditory Verbal Learning Test, The Trail making test, and the semantic association of verbal fluency. The symbol digit modalities test asked participants to pair abstract symbols with specific numbers as fast as possible in 90 seconds. The score shows the number of correctly matched symbols in a range from 0 to 110. The higher score indicates a faster processing speed. The rey auditory verbal learning test is a validated instrument that measures memory. In this test the participants were required memorize 15 words and after a 30 minute delay they were asked to recall the words. Then the recognition part of the test consisted of 30 words, 15 of the previous words intermixed with 15 words that are unrelated. The participants were asked if they recognized any of the words they were shown. From this they come up with 4 different scores the immediate recall score, learning effect score, a delayed recall score, and recognition score.The trail making test had 2 parts part a and b. Part a was a sheet of paper with 25 circles numbered 1-25 on it. The participants were asked to draw lines to connect the circles in ascending order. Part B consisted of 13 numbers and 12 Chinese characters placed randomly on a sheet of paper. The participants were then asked to connect the numbers alternating with numbers in ascending order. Part A tested selective attention and part B examined divided attention and the cognitive flexibility of executive function. The score was based of the time it took for the participants to finish the task. The semantic Association of Verbal Fluency test had 3 categories fruit, fish, and vegetables. The participants were asked to write down as many items that they could think of in each category in 1 minute. The results show that the intervention group improved significantly on the Symbol Digit Modalities Test (SDMT), the Rey Auditory Verbal Learning test (RAVLT) immediate recall, learning score, delayed recall and the semantic association of verbal fluency test. Where as the control group had no significant differences for any of the cognitive measurements.
What Do The Findings Mean?
The results showed the positive effects that aerobic dance group exercise has on the cognitive function of people with schizophrenia. The intervention group experienced significant changes in their processing speed, memory and executive functions, compared to the control group who had no significant changes. Due to cognitive impairment being a factor in schizophrenia clients, aerobic dancing could be an effective activity-based treatment that would help improve their cognitive functions.
What Are The Limitations of the Study?
One of the limitations of this study is the sample size. At the end of the study there was only 17 participants in the intervention group. If there was a larger sample size the results could have been more varied. Another limitation of the study was the informational monthly meeting was only held for the intervention group.
Cite this page
What is the Influence of Aerobic Dance on Cognitive Performance in Adults with Schizophrenia?. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Chronic Schizophrenia by Wesley Willis
In the song Chronic Schizophrenia, by Wesley Willis, from his album Rush Hour, he addresses how schizophrenia impacts him and what he goes through. His album Rush Hour was released in 2002. Willis did live with schizophrenia and it made him hear things. In a Los Angeles times article Willis goes on say that, The demon makes my life terrible...late '80s, I started hearing voices and was diagnosed with schizophrenia. Schizophrenia is a disorder that can cause a person to hallucinate and see or hear things that aren't real. Usually someone with this disorder affects their daily lives, as in they will not behave right or think normally.
Willis came from a broken home in Chicago. He would move home to home and sometimes didn't have a home. Next, he was later diagnosed with schizophrenia. He started to make music and was later discovered and signed to a record label. Willis did have a band called the Wesley Willis Fiasco, they made many albums. Willis was a punk/alternative artist, who would usually write songs about his schizophrenia and would mostly use his imagination. Willis did take medication for his illness and in the Los Angeles time article it states that, Willis typically carried with him a portable stereo with headphones and constantly listened to rock and heavy metal music, which he described as ""harmony joy music."" He said it quieted the ""schizophrenia demons"" in his head. This what inspired him to create this because Rush Hour was mostly just his imagination taking over. Sadly, Willis then developed chronic myelogenous leukemia, a type of cancer that starts when cells go out of whack and the cancer can spread anywhere in the body. He then died in August 21, 2003 because of the cancer.
From all of Willis's album, Rush Hour, critics didn't really have much to say about. In all Allmusic.com, Steve Huey, a music critic, did review it. He says that, Rush Hour isn't a significant departure from Willis' previous recordings with a full band. The musical backing still sounds oddly subdued, even canned, and Willis still takes long pauses in between his recitations. Somewhat surprisingly, Rush Hour doesn't have the loopy celebrity tributes Willis became known for; he relies more on his imagination to conjure up lyrical scenarios. Other than that, Rush Hour is pretty much a standard Wesley Willis album, with enough bizarre connections to make it a slightly more amusing listen than some of his other records. Steve Huey, the critic, shows how he is respecting the artist and that his album is good because there is something to the album that gives it meaning. Also in Ink19.com Marcel Feldmar said, Rush Hour is a solid tale of one man. Driving, talking about Jesus, talking to God, having car problems, and passing by strange and sometimes ugly characters. Throwing in bits heard on televisions, and basically laying down a life that's strange because it's all so real. Not always easy listening, but something that should be listened to. True stories spoken word confusion, and yeah, good times they're rock 'n' roll. This tell me that Rush Hour is something that is surreal. Also, this show me how that he is just really just a different person compared to other artist. I didn't find out about Willis or this song until now. While, researching him most of his music is about his disorder and how he feels. When picking the song I didn't think much of it. When doing my idp about schizophrenia I learned a lot about schizophrenia and what people can go through having this disorder. Though when learning about schizophrenia, when doing my idp I didn't get see what a person with this disorder feels and how they see themselves and Willis' song helped me see that.
The song, Chronic Schizophrenia, lines start by saying, My mind plays tricks on me every time I say something/It brings evil voices out of my head, and talks to me vulgar/Then suddenly I started raving. What Willis is trying say in these lines is how his disorder is messing with his head and how he hears voices, which are evil. When that happens to him he starts to go wild because of what is going through his head. After those lyrics he sings, Chronic schizophrenia/Chronic schizophrenia/Chronic schizophrenia/Chronic schizophrenia, these repeated lyrics symbolize his disorder and how its long lasting.
The next lines go on to say, But when when i have bad luck, I'll always hear evil voices talking to me vulgar/Everywhere I go riding on the CTA bus, all i hear is vulgarity/I hear no music at all. These lines are saying that on when he is having a bad day he starts to hear the voices again. He then only hears rude or disgusting things. The next lines are, Chronic schizophrenia, which are just repeated three more times. Then the song goes and says, Riding in the streets with no music sucks/Everywhere I go, I cruise the streets being called an asshole/Plus I'm being ridiculed and called a bum and called stupid. Willis is saying how people treat him when in public because of what he does because of his disorder. Also, that it sucks having no music when going around because then he is able to hear the people and as seen in the second paragraph it says the music helped quite is demons in his head and he isn't able to calm himself.
In the last lines in his song are, Pontiac, we build excitement. In the last line I had a hard time understanding it. I didn't know what the word pontiac was. When researching it, i found on definitions.net saying Pontiac was a, famous chief of the Ottawa who led an unsuccessful rebellion against the British. I also found that it was a car brand. By looking at all of the songs I could tell he was talking about the car because on one of his songs are titled, STP conked out my engine, which is talking about a car. So, I could assume that the line means that a Pontiac was his dream car and if he ever had that car it he would build excitement.
Ultimately, the song Chronic schizophrenia by Wesley willis is saying what he deals with living with his disorder and what it causes him to do. The song helps me and others see what a person with the disorder sees and what they actually feel when. Even though I have learned about schizophrenia and what it does. I also learned a lot analyzing the song. It helps give a different perspective and understanding what schizophrenia makes one feel or act.
Cite this page
Chronic Schizophrenia by Wesley Willis. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Schizophrenia: Long-term Mental Disorder
Schizophrenia, in dictionary definition is a long-term mental disorder of a type involving a breakdown in the relation between thought, emotion, and behavior, leading to faulty perception, inappropriate actions and feelings, withdrawal from reality and personal relationships into fantasy and delusion, and a sense of mental fragmentation. This disorder affects attention in various ways. From not being able to focus on one particular thing to constantly being distracted at the same time. Attention and vigilance tests were done in a number of different ways to evaluate attention. When finding all the various ways attention is affected in schizophrenia, I stumbled upon some research that had been done comparing schizophrenia to ADD. I learned some interesting things about the two. What I came to learn first was a gist of how schizophrenia works in the brain, with actual insight and direct quotes from schizophrenic patients. Barr explained that the inhibiting and facilitating properties of attention were both equally disturbed it felt contradictory to acknowledge that it is equally as hard to pay attention as it is to get distracted.
It was crazy to think that someone's attention can be conflicted like that. When a study/comparison on ADD and Schizophrenia was done, schizophrenic patients described the feeling as If I am somewhere where there is a lot going on, I am swinging from thing to another instead of concentrating on one thing and getting it done or Everything seems to grip my attention although I am not particularlyinterested in anything (BARR, WILLIAM B). Alongside this information, I also learned that there was distinction between early onset schizophrenia and the youth with ADD.I also learned attentional dysfunction is not specific to ADD, and is actually found almost all psychopathology, and that ADD and schizophrenia carry a unique relationship during adulthood. In a retrospective study, It showed that adults with schizophrenia showed signs of ADD when they were younger. During a virtual factory setting attention test, an interesting take on assessing schizophrenic patient's attention took place. What they did was tell patients to identify objects on a conveyor belt in a simulated real world setting.
Evaluations were done on affiliations between task performance and structural brain connectivity using this Diffusion Tensor Imaging (DTI). Through this DTI Test, selective attention (SA), divided attention (DA), and attentional shift (ASh) were looked at. When looking at DA, schizophrenic patients struggled more in this area than the healthy patients. Which to me was not surprising, because you would assume that of course the schizophrenic patient would struggle more in attention, but to my surprise it's only certain aspects of attention. What I came to find out was that there was no difference in SA. This got me thinking, are we able to improve those certain aspects of attention with brain exercises? And will doing this show faster improvement in schizophrenic patients?Low scores in DA and ASh were particularly notable in schizophrenic patients.
Latter seems to be correlated with lack in cognition and motivation, which are central to schizophrenia. They found that visual tasks seem to be an appropriate and correct way of evaluating attention in ways that are rare and that are not detected by standard measures.Sches journal raised the question on whether lack in attention/vigilance can be persistently and accurately measures across sites with variating factors such as demographic, clinical, and functional characteristics. I believe that Siddiqui would argue that there is reliable and accurate ways of measuring attention judging by how confident the virtual test went for them was and how when they finished testing they confidently stated they believe it asses attention in ways that are not standardly measured.
Cite this page
Schizophrenia: Long-term Mental Disorder. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
The Fantasy and Reality of Human Cloning
Day by day our scientific fantasies we once thought impossible are gradually becoming our reality: cloning falls under this category. It may not be as extreme as one imagines, but it is definitely occuring. Although dangers and unethical morals are consequences that will follow along, cloning, including its experiments, should be permitted because it will help advance our society. There are some places where they are attempting to ban cloning; However, all places should allow this to continue even if there has to be some restriction such as only allowing specific methods to use during the process.
Cloning can assist by advancing our society and by bringing different benefits, such as ending extinction, curing diseases, reviving animals, and producing goods. For starters, it serves as a solution to extinction if it's done correctly. However, this cannot be done unless research involving cloning is allowed everywhere. For instance, professor Beth Shapiro claims that, Only those whose tissue samples were taken and preserved before their extinction can be brought back in that way. Resurrecting long-dead species, including mammoths and passenger pigeons, will use different technologies, involving piecing together DNA sequences extracted from preserved bones and other remains (Should We Clone a Mammoth). They are developing a method which allows scientists to recreate certain animals that have been extinct, as long as they have saved the tissue from the animal. Furthermore, it will help humanity learn more about these animals and bring back animals that benefited the environment. To demonstrate, Shapiro explains that, Kangaroo rats are tiny environmental engineers whose complex burrow systems maintain the distribution and diversity of other species in their habitat. The domino effects of their disappearance include a rapid decline in plant diversity, which leads to a decline in seed-eating birds (Should We Clone a Mammoth).
They were essential to the environment, and if research on cloning continues, scientists would be able to revive them to better our world. Not only would it help us resurrect extinct animals, but it would prevent extinction altogether. For instance Wilmut explains that, ...an animal like a rhinoceros or an orangutan may have only about half a dozen offspring in a lifetime, so some of its genes are liable to remain uninherited...but if the breeding population is low...then the less common genes may well be contained within only one or a few individuals, and the individual containing the rarest genes may well finish its reproductive life without passing them on (Animal Cloning Could Be Beneficial). If only one kind of animal remains, it won't be able to reproduce in order to save its own species; thus cloning would come in handy because it wouldn't require another type of its kind to reproduce the same species, preventing it from dying out. In addition, this helps the human population as well because it can advance medicine. It can cure diseases we have trouble coming up with solutions for. For instance, it can help treat inbreeding, heart diseases, and macular degeneration (Monastersky A Second Life for Cloning). These are diseases that scientists have trouble dealing with but cloning provides new methods to surpass these setbacks; Hundreds of lives could be saved if they continue investigating and using such methods. Furthermore, it will help with the production of different products by creating more of what is already there in a quicker way. To demonstrate, farmers would be able to have quicker access to meat without the delay of having to breed his own animals. He would be able to select his best cattle and make exact copies (Wilmut Animal Cloning Could be Beneficial). In other words, cloning will not only let our environment thrive, but the life it sustains as well.
Cloning has been around for a while but the question is whether it should continue advancing. The first animal to be successfully cloned was a sheep they named Dolly. There have already been more animals that were cloned since then. For instance, there have been clones of rabbits, goats, frogs, and cows (Cloning). Something that should go into consideration is that there are different types of procedures available for cloning: The most known are reproductive, molecular and therapeutic.
Others think that the downsides of cloning would outweigh the good it would bring because there could be errors, overpopulation, diversity loss, and deaths. To begin, it isn't 100% accurate, meaning there have been and can be malfunctions during the process. For instance, when cloning human women would be at great risks, considering that they would be extracting her eggs in the process. Demonstrated when they state, Even if the creation of a cloned embryo were to be successful, surrogacy of such an embryo could pose unforeseen dangers to the surrogate. The offspring also could suffer from unknown birth defects and other medical challenges (Brainard After Heated Debate, U.S.). Not only would the woman be at risk, but there is a chance that there will be defects once the baby comes out. Likewise, there has already been malfunction when they have attempted to clone animals. For instance, British scientist John Gurdon made further progress six years later when he transferred the nucleus of a cell from the tadpole's intestine into a frog egg without a nucleus, but the tadpole still could not develop into an adult frog (Cloning). Although he was able to go through the progress, it didn't go as planned. Furthermore, cloning is a question of morality. Some people see embryos as humans and believe that destroying them for research isn't ideal. Similarly, it's perceived as destroying a human life and as an unnatural way to create life; Thus seen as unethical behavior. Even though cloning is an implication that babies are being murdered, there are different methods in which real embryos wouldn't necessarily be destroyed; Therefore, people wouldn't have to worry about killing a life. To illustrate, Dr. Hurlbut's suggested a process called altered nuclear transferthe process would create a 'biological artifact,' an embryo-like clone that could yield stem cells but could not progress beyond the very early stages of development (Monastersky A Second Life for Cloning). Moreover, its seen as an issue because there will be less diversity throughout humans and animals since they are creating exact replicas of a specific organism. Overtime, there would be less differences and less adaptations in the populations. Lastly, it can cause overpopulation if organisms are overproduced. The population on earth is already increasing, but if organisms were able to be created in large numbers, in a quicker amount of time, there will be overpopulation. Overall, cloning will bring benefits but it's a matter of how much you're willing to sacrifice for it; No one really knows the consequences that will occur, once it's done but some infer they're not worth it.
In other words, cloning outweighs the negative consequences it could potentially bring. It will help us advance and can change the way we live. It will bring upon new chances we didnt have before, so why shouldn't we give it a chance? Some may even perceive this as a waste of technology; They finally have these tools at hand, and it would be tragic if they didn't use them to improve the world. There is no major harm as long as there are limitations, such as only being able to clone if they use the altered nuclear transfer method. Providing this, scientists should continue their research with cloning only using methods that have the minimum damage.
Cite this page
The Fantasy and Reality of Human Cloning. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Cloning and Expressing of Aryl Alcohol Oxidase
Abstract: Cellulose fuel ethanol does great significance on solving the energy crisis and reducing environment pollution. However, in the process of industrially degrading cellulose into ethanol, it is difficult to directly degrade the cellulose because of the presence of the lignin barrier. While the aryl alcohol oxidase is responsible for providing H2O2 to initiate the enzymatic reaction of lignin peroxiadase and manganese peroxidase in the lignin degradation system of white rot fungi. In this study, we obtained the cDNA of aryl alcohol oxidase by obtaining the white fungi RNA and then carrying out reverse transcription method, and transforming it into Pichia pastoris for heterologous expression to collect aryl alcohol oxidase. Subsequent purification was performed for further use.
Key Words: white rot fungi; aryl alcohol oxidase; Pichia pastoris
Introduction
Because of the decreasing of oil production and Greenhouse Effect, people turn to new energy while one of them is cellulose fuel ethanol. [1][2] However, several challenges occur during the catalytic process from cellulose to alcohol. One of the challenges is what we call “lignin barrier”, which is a network around the cellulose composed of lignin and hemicellulose by covalent bond.[3] The existence of lignin barrier will hinder the contact between cellulose and its catalyst. Meanwhile, an enzyme system from white rot fungi which can degrade the lignin barrier efficiently has been reported.[3] This enzyme system contains several enzymes like laccase(Lac), manganese peroxidase(MnP), lignin peroxidase(LiP), aryl alcohol oxidase(AAO), etc.[3][4] The function of AAO is to provide H2O2 to start the reaction catalyzed by MnP or LiP.[5][6] One characteristic of AAO is that is can oxidize alcohol to aldehyde.[7] In our study, we cloned the gene of AAO and transformed it into Pichia pastoris which is suitable host to express exogenous gene. Then we cultivate the yeast and detect the enzymatic activity every day. When the enzymatic activity peaked, we separated AAO from formented liquid and purified it by dialysis and anion exchange resin. We then calculated the output and enzymatic activity of our AAO and compared it with the nature one to find that whether the expression and enzymatic activity of exogenous AAO gene is remarkable to be used in industry or not.
Results
Obtain the AAO Gene
Fig.1 Blast analysis of AAO gene we obtained. The first one is hypothesis so it is excluded. The second one is AAO gene and the similarity between is 98%.
By inverse transcription and polymerase chain reaction (PCR) we can get the sequence of AAO. We can draw the conclusion the we successfully obtained the AAO genes using Blast analysis (Fig.1).
Analysis of AAO cds
Fig.2 Amino acid sequence of AAO cds..
Using Expasy to translate our AAO cds we can draw the amino acid sequence of AAO. Message we can gain from the amino acid sequence is that AAO is composed of 593 amino acids and its molecular weight is 63683.40. By analyzing its amino acid sequence we can learn more about its spatial structure and how it works.
Enzymatic Activity
Material and Methods
Obtain the AAO Gene First, we had used the Trizol method to obtain all the RNA of Pleurotus ostreatus BP3, one kind of white rot fungi. The we degraded it by applying RNase and obtained the AAO RNA sequence by electrophoresis. After that the AAO DNA sequence was obtained by inverse transcription and was amplified by PCR.
Formulation and Transformation of the Plasmid Carrier
Fig.2 Anticipated formulation of plasmid carrier. AOX1 promoter only can be activated by methyl alcohol so we can control the start of AAO expression. CYC1 terminator is used to stop the expression. Before and after AAO sequence there are two restriction sites for EcoR 1 and Xba 1.
We use pPICZ?A plasmid for our formulation. First, we use EcoR 1 and Xba 1 for a double-restriction on the plasmid. Then we can ligate AAO DNA sequence to both ends by a Vazyme kit during PCR. [8] The primer is designed as:
HAAO-F?
AGAGAGGCTGAAGCTGAATTCAACCTCCCAACCGCTGATTTTGATTA
HAAO-R?
GAGATGAGTTTTTGTTCTAGACTACTGATCAGCCTTAATAAGATCGGC
After that the pPICZ?A-AAO plasmid was transformed into Pichia pastoris and was expressed as exogenous gene.
Detection of Enzymatic Activity The enzymatic activity was calculated according to a reaction catalyzed by AAO from mannitol to mannuronate. The latter owns a absorption peak at 330 nm.[9] The absorption of this reaction system at 330nm is monitored by an ELIASA and according to its variation we can get a slope. The enzymatic activity should be inferred by this equation[9]:
enzymatic activity?""U/L""?=(slope×""10^6"" ×""0.2"" )/(""9300"" ×""0.625"" ×""0.01"" )
In this equation, 0.2 stands for the volume of reaction system (0.2ml), 9300 equals ??9300M-1cm-1?, 0.625 means the optical path is 0.625cm and 0.01 is the volume of liquid which is used for ELIASA to detect.
Discussion and Conclusion
From the final enzymatic activity we can draw the conclusion that the output and enzymatic activity of exogenous AAO gene is similar to/better than nature white rot fungi.[10] For this reason, we can deem that our idea to express AAO in Pichia pastoris is feasible to be apply to industry in order to degrade the lignin barrier. That will directly lead to the progression of efficient to catalyze cellulose to alcohol.
Acknowledgements
This study is supported by my tutor Dr.Wang and my senior Miss.Gong.
Cite this page
Cloning and Expressing of Aryl Alcohol Oxidase. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Is Financial Incentive an Effective Way to Increase the Organ Donation Rate
Good health is indispensable and an important asset to everyone. In present-day society, it is nothing but the truth that the possibility of fostering organ donation by financial incentive is receiving increasing consideration. Therefore, whether the financial incentive is an effective way to increase the organ donation rate has long remained disputable discussion in the society. On the one hand, People who are in favor of the suggestion conceive that financial incentive can attract citizens to donate organs and increase the supply of organs. On the other hand, people who object to the notion take the stance that attracting people to donate organs by financial incentive is unethical. Personally, I agree that financial incentive is not an effective way to increase the organ donation way. In this essay, I will examine both sides of the argument and establish my own stance.
Tradition is one of the major components
In this day and age, a lot of people are devoted to discussing the topic of financial incentive for organ donation. People who objected to the statement expect that financial incentive for organ donation may cause potential traditional dilemmas. After thorough examination, it can be reasonably concluded the policy would do more harm than good. According to a recent survey that conducted by the United Network for Organ Sharing (UNOS), it has been discovered that only 31 percent of individuals who are older than 55 years old are in favor of some form of financial incentive. Also, this attitude increase with age. Let's use China as an example. Chinese have a traditional concept that our body should be interred intact and this attitude still remains strong among the elderly. The former vice health minister Huang Jiefu said that China is a Confucian society. It's strongly hierarchical and the family's concerns usually trump those of the individual. Therefore, the Chinese, especially older Chinese, put emphasis on this traditional culture. Although financial incentive can provide benefits to them, it is more important for them to follow these cultures. Also, the Chinese believe that our body is received from our parents and we must not presume to injure our body. Therefore, this traditional concept has become an inability of family that affect the aspiration of donating organ. These Chinese traditional values are deeply ingrained in our society so it is hard to attract people to donate organ by financial incentive. After serious discussion, it can draw that financial incentive for organ donation is ineffective to increase the organ donation rate.
Financial incentive is unethical
Besides, there has been much controversy about whether financial incentive for organ donation is ethical or not. People who disagree with such a policy conceive that financial incentive is unethical and violating human rights. Let's quote a specific example. In 1984, a regulation to allow the removal of organs from prisoners is approved by the Chinese government. Until 2006, the former vice health minister Huang Jiefu admitted that more than 95 percent of the supply of organs are from prisoners. The number of executions has estimated that there are about 6000 to 8000 prisoners were executed yearly. However, it cannot determine that how many of them agree to donate their organs by themselves but not compel by the law or financial benefits. Hence, components of financial incentive for organ donation are convinced that the respect of life will reduce and sanctity of human body will decrease. Some may agree to donate organ because of the attraction of financial incentive but the meaning of organ donation will be lost. If family members can determine whether getting the financial incentive for organ donation for the dead, the human rights of the deceased will be ignored. Also, the reliance on prisoners for organs may ignore the standard safeguards of them. Hence, the financial incentive for organ donation is unethical and it is ineffective to raise the organ donation rate.
Whether financial incentive can attract people to donate organ
Financial incentive for organ donation has become a talk of town that whether it can increase the organ donation rate effectively. Supporters are of the opinion that people will be attracted by the financial incentive so the supply of organ will increase. In accordance with a recent questionnaire that conducted by the United Network for Organ Sharing (UNOS) , it has been shown that more than 50 percent of individuals agree with the policy of financial incentive for organ donation. Surprisingly, 68 percent of those under 35 years old are strongly in favor of such policy. It can discover that some traditional concepts are gradually changing. Young people are more willing to accept financial incentive as they put more attention to the advantages that they can get through financial incentive for organ donation. However, organ donation is not a self-determination. Young people still need to consider the opinion of their family members. Young people should discuss with family members before making the decision. If there are family members who are elderly that has strong traditional concepts, the attraction of financial incentive will decrease. Therefore, the organ donation rate will hard to increase and financial incentive will become ineffective.
Conclusion
The growing influence of low organ donation rate has alarmed the public. It calls urgently requires the concerns of everyone to think of an effective solution to put a halt to this issue. It is our hope to live in affluence but also living healthily. Hence, we should strike a balance between two sides of opinion and work hand in hand to find out the most effective solution to increase the organ donation rate.
Cite this page
Is financial incentive an effective way to increase the organ donation rate. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
The Dalai Lama and Dolly the Lamb
The Dalai Lama and Dolly the lamb, what could these two possibly have in common? The Dalai Lama being the spiritual leader of Tibetan Buddhism and Dolly, a lamb. The answer is nothing except a confused middle schooler in science class. I first heard about Dolly the lamb and confused it with the Dalai Lama. I believed the Dalai Lama to be a person that was being cloned over and over to allow for the same spiritual leader into perpetuity. The reality is that Dolly the lamb was the first mammal generated using reproductive cloning (Singh-Cundy.) What exactly does cloning mean and where does it show up in everyday life?
According to Michael Rugnetta, a writer for Brittanica.com, cloning is a process used to create an identical genetic copy of a cell or an organism. It occurs regularly within prokaryotic organisms like bacteria that use binary fission to replicate. Do eukaryotic organisms use cloning as well? Yes, they do, the skin cells of the body are created through mitosis which creates two identical daughter cells. However, the human body also has sexual reproductive organs that use meiosis and create gametes that help increase diversity within the population (Singh-Cundy.) Reproductive cloning requires three steps. The first necessitates an egg is taken from a donor and the nucleus is removed. Second, an electrical current is used to fuse the egg and with a somatic cell and chemicals are added to trick the cells into forming an embryo. Finally, the embryo is implanted into a surrogate mother and fingers crossed, a baby animal is born (Singh-Cundy.) This specific type of cloning used to make Dolly is something we hear about every so often in the news, this family paid an exorbitant amount of money to clone their beloved family dog. Barbra Streisand paid for her dog, Sammie to be cloned and the process created five puppies, three of which she kept (Streisand.) A gentleman from Louisiana paid more than $100,000 to a foundation in Korea to have his dog cloned and he is not alone. The organization in Korea is not the only one of its kind, in Texas, another company called ViaGen has established a cloning animal operation. The company originally cloned horses and livestock but, they have switched gears to land in the cloning of house pets (Landman.) Cloning is used to create loved pets, does it appear anywhere else? It has appeared in livestock such as sheep, horses, and pigs.
Livestock cloning was were this reproductive cloning started but, where has it gone? Are people drinking milk produced from cows that are clones, are people eating steaks from a cloned a cow? If we are consuming these goods, are we endangering ourselves? The FDA states that eating cloned animals poses no additional risks to the consumer. Due to that determination no labels need to be placed on food that may be made from cloned animals. However, cloned animals are mainly used to reproduce the best breeding stock and then those animals are allowed to breed. The offspring of the cloned animals are then the ones to be consumed (USDA.) In a contradicting article written by the Center for Food Safety, it states that the cloned animals struggle with reproducing healthy offspring and often become lame. The propensity for these problems would lead to a higher amount of antibiotics and hormones given to the animals. An additional article also calls into question the study size used by the FDA to say cloned food is safe. The article claims one of the studys only had six animals that had their milk and meat analyzed. If the FDA had originally based all their claims on this study, done by the University of Connecticut, it would hold no value, as six animals is too small a group size to draw any claims on (Scientific American.) The FDA states that since the use of that study from 2008, hundreds of cloned animals have been observed.
The act of cloning seems to play an increasing part in our day to day life. The question of whether we are eating cloned food, isn't able to be distinctly answered. We may be but, until the government decides to pass legislation to make it necessary to tell the public, we won't know.
Cite this page
The Dalai Lama and Dolly the Lamb. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
Highly Discussed Topic: Cloning
Despite the wide debates, very few actually know and argue the facts about cloning. To clone a horse, or any animal, cells need to be taken from a donor. Usually, these cells are appropriated from the ears or chest of the animal. After these cells are retrieved, they have several different options for destinations. They can be placed into a nucleus-lacking, unfertilized egg or genetically engineered into an embryo. Once that step is finalized, they are either jolted with a pulse of electricity to start cell division or they are frozen for later use. The ones that have begun to divide are usually placed into a surrogate's or host's uterus to continue on in normal gestation. They also can be used to cultivate organ tissues. The first clone was produced in 1997 and is known as Dolly the Sheep. Then, in 2003, a horse and 3 mules were successfully cloned in a similar style as Dolly. In 2013, not too long ago, Dr. Shoukhart Mitalipov stated that cloning these days is just a science project. This lead many to believe that it would never evolve into anything worthwhile. In today's world, very little cloning is actually taking place. Some scientist have begun to attempt to clone endangered species to try to preserve them. Many scientists claim that cloning could affect the future of medicines, tissue regeneration, embryology, cancer treatments, and solutions for infertility, to name just a few.
Cloning has 2 main methods. The first is how Dolly the sheep was created. DNA is taken from skin cells of a donor, put into an egg without a nucleus, charged with an electrical pulse to start cell division, and then placed into a host uterus to develop in normal gestation. The second way is when DNA is taken from skin cells then genetically engineered back into an embryotic state. The embryo is either placed into an animal to grow into a fetus or is grown into different types of tissues t be used later on. Today's technology could morph into infertility solutions, but numerous scientists argue that it is too unpredictable and unsafe to perform on humans. Equine communities are slowly starting to accept cloned animals into sporting events, but many competitors are still against this new exception to the old rules. The world has the technology to clone nearly anything and everything ;however, ethics, morals, and safety always come into question. Most would agree that it needs to have improved accuracy and stability before it goes any further. If the word cloning were to be spoken in any given conversation, many would agree that it corresponds directly to money, specifically large amounts of it. Since so many animals have been cloned, there is a sizeable range of costs. Some of the cheapest cloning methods involve pets, more specifically, cats and dogs. They range anywhere from $25,000 to $50,000.
To most, that amount of money could be equivalent to the price of a small used car! Coming in at around $40,000 is cattle. Cattle is usually not a choice to be cloned because of their low value, other than for meat or genetics purposes. Horses are one of the biggest industries of cloning, because of their variety of uses and general value. In Texas, a company claims to be able to clone a horse to produce a live foal for $150,000! That is the price of a decent sized home for many Americans! Most of the horses cloned at that facility are champion horses. This is mainly done to pass on genetics when a gelding's sperm was not saved before castration. Human cloning has been estimated to cost upwards of $2 million dollars! However, because it hasn't been achieved, the price is just an approximation. Many frown upon the costs of cloning because of the time-to-cost ratio. It takes a prolonged amount of time for a product to result for the amount of money that it costs to produce a clone. Also, the system does not have a 100% guarantee, meaning that large investment could be wasted money. Personally, I think cloning is a poor definition choice for what is actually being done. Technically, an exact copy offspring can not be resulted because of the workings of DNA.
However, I do see the benefits of cloning technologies in the medicinal fields. Infertility is a big tabooed topic these days, mainly because many don't understand it and there aren't many solutions to the numerous problems. Also, cancer has affected many people on this earth, so if cloning can either reduce those numbers or eliminate them completely, the medicinal world will be majorly befitted. I feel these subjects should only be approached with cloning when it safety, morality, and techniques are perfected to protect everyone and everything involved. On the topic of infertility, I also believe that designer babies should not be allowed. Parents, no matter how desperate they be, should not be allowed to design their own offspring. It makes it seem as if they are trying to play God. As far as livestock, I am on the fence. I can see the benefit of cloning in horses and endangered species to preserve blood lines and keep certain genetics going, but it appears to be meaningless otherwise.
Pets may seem like a member of the family to some owners, but I wouldn't go as far as cloning them to have the same pet again. Clones, in my opinion, should not be allowed to compete in sporting events like rodeos or showing events. It seems like a loophole to cheating, despite the new rules condoning it. In conclusion, cloning will always be a highly debated topic, and, despite technological advances, morality, ethics, and safety will always need to be questioned. I have no doubt that cloning can change the world, for the better at least. Until then, we as humans cannot allow ourselves to play the role of God. Science, as many other subjects, needs to have its limits and scientists need to know where to draw their lines.
Cite this page
Highly Discussed Topic: Cloning. (2019, Aug 08).
Retrieved November 5, 2025 , from
https://studydriver.com/2019/08/page/15/
