Abstract: Cellulose fuel ethanol does great significance on solving the energy crisis and reducing environment pollution. However, in the process of industrially degrading cellulose into ethanol, it is difficult to directly degrade the cellulose because of the presence of the lignin barrier. While the aryl alcohol oxidase is responsible for providing H2O2 to initiate the enzymatic reaction of lignin peroxiadase and manganese peroxidase in the lignin degradation system of white rot fungi. In this study, we obtained the cDNA of aryl alcohol oxidase by obtaining the white fungi RNA and then carrying out reverse transcription method, and transforming it into Pichia pastoris for heterologous expression to collect aryl alcohol oxidase. Subsequent purification was performed for further use.
Key Words: white rot fungi; aryl alcohol oxidase; Pichia pastoris
Because of the decreasing of oil production and Greenhouse Effect, people turn to new energy while one of them is cellulose fuel ethanol. [1][2] However, several challenges occur during the catalytic process from cellulose to alcohol. One of the challenges is what we call “lignin barrier”, which is a network around the cellulose composed of lignin and hemicellulose by covalent bond.[3] The existence of lignin barrier will hinder the contact between cellulose and its catalyst. Meanwhile, an enzyme system from white rot fungi which can degrade the lignin barrier efficiently has been reported.[3] This enzyme system contains several enzymes like laccase(Lac), manganese peroxidase(MnP), lignin peroxidase(LiP), aryl alcohol oxidase(AAO), etc.[3][4] The function of AAO is to provide H2O2 to start the reaction catalyzed by MnP or LiP.[5][6] One characteristic of AAO is that is can oxidize alcohol to aldehyde.[7] In our study, we cloned the gene of AAO and transformed it into Pichia pastoris which is suitable host to express exogenous gene. Then we cultivate the yeast and detect the enzymatic activity every day. When the enzymatic activity peaked, we separated AAO from formented liquid and purified it by dialysis and anion exchange resin. We then calculated the output and enzymatic activity of our AAO and compared it with the nature one to find that whether the expression and enzymatic activity of exogenous AAO gene is remarkable to be used in industry or not.
Obtain the AAO Gene
Fig.1 Blast analysis of AAO gene we obtained. The first one is hypothesis so it is excluded. The second one is AAO gene and the similarity between is 98%.
By inverse transcription and polymerase chain reaction (PCR) we can get the sequence of AAO. We can draw the conclusion the we successfully obtained the AAO genes using Blast analysis (Fig.1).
Analysis of AAO cds
Fig.2 Amino acid sequence of AAO cds..
Using Expasy to translate our AAO cds we can draw the amino acid sequence of AAO. Message we can gain from the amino acid sequence is that AAO is composed of 593 amino acids and its molecular weight is 63683.40. By analyzing its amino acid sequence we can learn more about its spatial structure and how it works.
Material and Methods
Obtain the AAO Gene First, we had used the Trizol method to obtain all the RNA of Pleurotus ostreatus BP3, one kind of white rot fungi. The we degraded it by applying RNase and obtained the AAO RNA sequence by electrophoresis. After that the AAO DNA sequence was obtained by inverse transcription and was amplified by PCR.
Formulation and Transformation of the Plasmid Carrier
Fig.2 Anticipated formulation of plasmid carrier. AOX1 promoter only can be activated by methyl alcohol so we can control the start of AAO expression. CYC1 terminator is used to stop the expression. Before and after AAO sequence there are two restriction sites for EcoR 1 and Xba 1.
We use pPICZ?A plasmid for our formulation. First, we use EcoR 1 and Xba 1 for a double-restriction on the plasmid. Then we can ligate AAO DNA sequence to both ends by a Vazyme kit during PCR. [8] The primer is designed as:
HAAO-F?
AGAGAGGCTGAAGCTGAATTCAACCTCCCAACCGCTGATTTTGATTA
HAAO-R?
GAGATGAGTTTTTGTTCTAGACTACTGATCAGCCTTAATAAGATCGGC
After that the pPICZ?A-AAO plasmid was transformed into Pichia pastoris and was expressed as exogenous gene.
Detection of Enzymatic Activity The enzymatic activity was calculated according to a reaction catalyzed by AAO from mannitol to mannuronate. The latter owns a absorption peak at 330 nm.[9] The absorption of this reaction system at 330nm is monitored by an ELIASA and according to its variation we can get a slope. The enzymatic activity should be inferred by this equation[9]:
enzymatic activity?""U/L""?=(slope×""10^6"" ×""0.2"" )/(""9300"" ×""0.625"" ×""0.01"" )
In this equation, 0.2 stands for the volume of reaction system (0.2ml), 9300 equals ??9300M-1cm-1?, 0.625 means the optical path is 0.625cm and 0.01 is the volume of liquid which is used for ELIASA to detect.
Discussion and Conclusion
From the final enzymatic activity we can draw the conclusion that the output and enzymatic activity of exogenous AAO gene is similar to/better than nature white rot fungi.[10] For this reason, we can deem that our idea to express AAO in Pichia pastoris is feasible to be apply to industry in order to degrade the lignin barrier. That will directly lead to the progression of efficient to catalyze cellulose to alcohol.
This study is supported by my tutor Dr.Wang and my senior Miss.Gong.
Cloning and Expressing of Aryl Alcohol Oxidase. (2019, Aug 08).
Retrieved October 5, 2026 , from
https://studydriver.com/cloning-and-expressing-of-aryl-alcohol-oxidase/
A professional writer will make a clear, mistake-free paper for you!
Get help with your assignmentPlease check your inbox
Hi!
I'm Amy :)
I can help you save hours on your homework. Let's start by finding a writer.
Find Writer